Incidental Mutation 'R6712:Ngdn'
ID529181
Institutional Source Beutler Lab
Gene Symbol Ngdn
Ensembl Gene ENSMUSG00000022204
Gene Nameneuroguidin, EIF4E binding protein
Synonyms1500001L15Rik, Ngd, neuroguidin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6712 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55015454-55024137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55016188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000022815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022815]
Predicted Effect probably benign
Transcript: ENSMUST00000022815
AA Change: V11A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022815
Gene: ENSMUSG00000022204
AA Change: V11A

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 18 98 1.3e-18 PFAM
low complexity region 142 170 N/A INTRINSIC
low complexity region 296 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,332,888 T443M probably damaging Het
Ankmy1 A T 1: 92,870,922 V950D probably damaging Het
Cep350 T C 1: 155,858,106 K3014E possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dmxl2 A G 9: 54,411,624 Y1586H probably damaging Het
Dnah11 A T 12: 118,050,722 I2010N probably damaging Het
Dock10 T A 1: 80,536,866 M1446L probably benign Het
E430018J23Rik A T 7: 127,392,310 H168Q probably damaging Het
Fcmr T C 1: 130,877,851 L274P probably damaging Het
Foxn1 T G 11: 78,361,259 D382A probably damaging Het
Gpr179 T C 11: 97,336,167 R1721G possibly damaging Het
H2afj A G 6: 136,808,526 I63V probably benign Het
Mfsd9 T C 1: 40,786,441 probably null Het
Mis18a T C 16: 90,727,157 E39G possibly damaging Het
Mmp27 A T 9: 7,572,176 T126S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myo5a A C 9: 75,212,900 D1635A probably benign Het
Nlrc4 A T 17: 74,446,836 M184K probably damaging Het
Olfr63 T G 17: 33,269,268 H181Q possibly damaging Het
Olfr672 A T 7: 104,996,418 I162K possibly damaging Het
Peli2 C A 14: 48,250,594 Q81K probably benign Het
Pfdn2 T A 1: 171,357,851 I97K probably damaging Het
Pknox1 C A 17: 31,595,316 T205K probably benign Het
Polh T C 17: 46,190,729 S179G probably benign Het
Ppp4r4 G A 12: 103,596,443 R557Q probably damaging Het
Sipa1 A T 19: 5,660,819 D54E possibly damaging Het
Tmc8 C A 11: 117,784,813 N185K probably benign Het
Tns1 C A 1: 74,079,301 E57* probably null Het
Tyro3 G A 2: 119,804,854 A209T probably null Het
Ube2f T A 1: 91,276,449 C116S possibly damaging Het
Vmn1r231 T C 17: 20,889,730 T308A possibly damaging Het
Wwc2 T A 8: 47,900,803 M99L probably benign Het
Zfp516 C T 18: 82,957,308 R544C probably damaging Het
Other mutations in Ngdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ngdn APN 14 55023169 missense probably damaging 0.99
IGL01301:Ngdn APN 14 55017114 missense probably benign 0.15
IGL02350:Ngdn APN 14 55021936 missense probably damaging 1.00
IGL02357:Ngdn APN 14 55021936 missense probably damaging 1.00
ANU18:Ngdn UTSW 14 55017114 missense probably benign 0.15
PIT4651001:Ngdn UTSW 14 55016200 missense probably benign 0.05
R2062:Ngdn UTSW 14 55022107 missense possibly damaging 0.93
R2251:Ngdn UTSW 14 55023395 critical splice donor site probably null
R5167:Ngdn UTSW 14 55022199 nonsense probably null
R5492:Ngdn UTSW 14 55023052 missense probably benign 0.00
R6174:Ngdn UTSW 14 55022099 missense probably benign 0.38
R7866:Ngdn UTSW 14 55021097 missense probably damaging 1.00
R8303:Ngdn UTSW 14 55023145 missense probably benign 0.01
X0025:Ngdn UTSW 14 55021915 missense possibly damaging 0.71
Z1177:Ngdn UTSW 14 55021944 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCGGTCTTTTCCAGTAAATTGGG -3'
(R):5'- CTTTCATGAAGCGCATATAAGGC -3'

Sequencing Primer
(F):5'- AGGAGACTGGCTGTGTGC -3'
(R):5'- GCGCATATAAGGCTTTTATTTTACAC -3'
Posted On2018-07-24