Incidental Mutation 'R6712:Vmn1r231'
ID 529183
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 044830-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21109992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 308 (T308A)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061278
AA Change: T308A

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: T308A

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,551,862 (GRCm39) T443M probably damaging Het
Ankmy1 A T 1: 92,798,644 (GRCm39) V950D probably damaging Het
Cep350 T C 1: 155,733,852 (GRCm39) K3014E possibly damaging Het
Col5a3 C T 9: 20,690,329 (GRCm39) G1162R probably damaging Het
Dmxl2 A G 9: 54,318,908 (GRCm39) Y1586H probably damaging Het
Dnah11 A T 12: 118,014,457 (GRCm39) I2010N probably damaging Het
Dock10 T A 1: 80,514,583 (GRCm39) M1446L probably benign Het
Fcmr T C 1: 130,805,588 (GRCm39) L274P probably damaging Het
Foxn1 T G 11: 78,252,085 (GRCm39) D382A probably damaging Het
Gpr179 T C 11: 97,226,993 (GRCm39) R1721G possibly damaging Het
H2aj A G 6: 136,785,524 (GRCm39) I63V probably benign Het
Mfsd9 T C 1: 40,825,601 (GRCm39) probably null Het
Mis18a T C 16: 90,524,045 (GRCm39) E39G possibly damaging Het
Mmp27 A T 9: 7,572,177 (GRCm39) T126S probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Myo5a A C 9: 75,120,182 (GRCm39) D1635A probably benign Het
Ngdn T C 14: 55,253,645 (GRCm39) V11A probably benign Het
Nlrc4 A T 17: 74,753,831 (GRCm39) M184K probably damaging Het
Or10h28 T G 17: 33,488,242 (GRCm39) H181Q possibly damaging Het
Or52e15 A T 7: 104,645,625 (GRCm39) I162K possibly damaging Het
Peli2 C A 14: 48,488,051 (GRCm39) Q81K probably benign Het
Pfdn2 T A 1: 171,185,419 (GRCm39) I97K probably damaging Het
Pknox1 C A 17: 31,814,290 (GRCm39) T205K probably benign Het
Polh T C 17: 46,501,655 (GRCm39) S179G probably benign Het
Ppp4r4 G A 12: 103,562,702 (GRCm39) R557Q probably damaging Het
Sipa1 A T 19: 5,710,847 (GRCm39) D54E possibly damaging Het
Tmc8 C A 11: 117,675,639 (GRCm39) N185K probably benign Het
Tns1 C A 1: 74,118,460 (GRCm39) E57* probably null Het
Tyro3 G A 2: 119,635,335 (GRCm39) A209T probably null Het
Ube2f T A 1: 91,204,171 (GRCm39) C116S possibly damaging Het
Wwc2 T A 8: 48,353,838 (GRCm39) M99L probably benign Het
Zfp516 C T 18: 82,975,433 (GRCm39) R544C probably damaging Het
Zfp764l1 A T 7: 126,991,482 (GRCm39) H168Q probably damaging Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTAAAGGGCAACTCCTTC -3'
(R):5'- ACATTCTGGTGCTAGTGTCAC -3'

Sequencing Primer
(F):5'- TGAGTAAAGGGCAACTCCTTCATTCC -3'
(R):5'- GCTAGTGTCACTCTTTATTGGC -3'
Posted On 2018-07-24