Incidental Mutation 'R6712:Olfr63'
ID529186
Institutional Source Beutler Lab
Gene Symbol Olfr63
Ensembl Gene ENSMUSG00000054666
Gene Nameolfactory receptor 63
SynonymsGA_x6K02T2NTC5-9778-8828, M4, MOR267-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6712 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33264676-33275644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33269268 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 181 (H181Q)
Ref Sequence ENSEMBL: ENSMUSP00000150323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067840] [ENSMUST00000217023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067840
AA Change: H181Q

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067207
Gene: ENSMUSG00000054666
AA Change: H181Q

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7tm_1 42 288 5.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215466
Predicted Effect possibly damaging
Transcript: ENSMUST00000217023
AA Change: H181Q

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,332,888 T443M probably damaging Het
Ankmy1 A T 1: 92,870,922 V950D probably damaging Het
Cep350 T C 1: 155,858,106 K3014E possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dmxl2 A G 9: 54,411,624 Y1586H probably damaging Het
Dnah11 A T 12: 118,050,722 I2010N probably damaging Het
Dock10 T A 1: 80,536,866 M1446L probably benign Het
E430018J23Rik A T 7: 127,392,310 H168Q probably damaging Het
Fcmr T C 1: 130,877,851 L274P probably damaging Het
Foxn1 T G 11: 78,361,259 D382A probably damaging Het
Gpr179 T C 11: 97,336,167 R1721G possibly damaging Het
H2afj A G 6: 136,808,526 I63V probably benign Het
Mfsd9 T C 1: 40,786,441 probably null Het
Mis18a T C 16: 90,727,157 E39G possibly damaging Het
Mmp27 A T 9: 7,572,176 T126S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myo5a A C 9: 75,212,900 D1635A probably benign Het
Ngdn T C 14: 55,016,188 V11A probably benign Het
Nlrc4 A T 17: 74,446,836 M184K probably damaging Het
Olfr672 A T 7: 104,996,418 I162K possibly damaging Het
Peli2 C A 14: 48,250,594 Q81K probably benign Het
Pfdn2 T A 1: 171,357,851 I97K probably damaging Het
Pknox1 C A 17: 31,595,316 T205K probably benign Het
Polh T C 17: 46,190,729 S179G probably benign Het
Ppp4r4 G A 12: 103,596,443 R557Q probably damaging Het
Sipa1 A T 19: 5,660,819 D54E possibly damaging Het
Tmc8 C A 11: 117,784,813 N185K probably benign Het
Tns1 C A 1: 74,079,301 E57* probably null Het
Tyro3 G A 2: 119,804,854 A209T probably null Het
Ube2f T A 1: 91,276,449 C116S possibly damaging Het
Vmn1r231 T C 17: 20,889,730 T308A possibly damaging Het
Wwc2 T A 8: 47,900,803 M99L probably benign Het
Zfp516 C T 18: 82,957,308 R544C probably damaging Het
Other mutations in Olfr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr63 APN 17 33269655 missense probably benign 0.00
IGL02313:Olfr63 APN 17 33269665 missense probably benign
IGL02639:Olfr63 APN 17 33269395 missense possibly damaging 0.96
IGL02851:Olfr63 APN 17 33269354 missense probably benign 0.01
IGL03007:Olfr63 APN 17 33268883 missense probably damaging 0.98
IGL03206:Olfr63 APN 17 33268751 missense possibly damaging 0.46
R0143:Olfr63 UTSW 17 33269497 missense probably damaging 1.00
R0355:Olfr63 UTSW 17 33269135 missense probably damaging 0.98
R1115:Olfr63 UTSW 17 33268966 nonsense probably null
R1117:Olfr63 UTSW 17 33268966 nonsense probably null
R1567:Olfr63 UTSW 17 33269476 missense probably benign
R1986:Olfr63 UTSW 17 33269515 missense probably benign 0.00
R3905:Olfr63 UTSW 17 33268775 missense probably damaging 1.00
R4612:Olfr63 UTSW 17 33269480 missense probably benign 0.20
R5650:Olfr63 UTSW 17 33268884 missense probably benign 0.05
R5855:Olfr63 UTSW 17 33269336 missense possibly damaging 0.81
R7873:Olfr63 UTSW 17 33269374 missense probably benign
X0026:Olfr63 UTSW 17 33269050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGACCGCTATGTGGCCATC -3'
(R):5'- AGCCGTAGTGCACAATCAC -3'

Sequencing Primer
(F):5'- CCATCTGCCGCCCCCTG -3'
(R):5'- CACATGTGGAGAATGTCTTGTGCC -3'
Posted On2018-07-24