Incidental Mutation 'R6713:Slc6a17'
ID 529200
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 044831-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R6713 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 107378703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 660 (M660L)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably benign
Transcript: ENSMUST00000029499
AA Change: M657L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: M657L

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168211
AA Change: M619L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: M619L

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169449
AA Change: M660L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: M660L

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171029
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a C T 15: 77,373,051 (GRCm39) T229M possibly damaging Het
Cdh16 G A 8: 105,346,617 (GRCm39) Q226* probably null Het
Cemip A T 7: 83,592,845 (GRCm39) N1227K probably benign Het
Dusp13b A G 14: 21,798,541 (GRCm39) V41A probably damaging Het
F3 C T 3: 121,525,323 (GRCm39) T53I possibly damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fyb2 T A 4: 104,847,432 (GRCm39) M484K probably benign Het
Glb1l A T 1: 75,179,061 (GRCm39) H253Q probably benign Het
Grm8 T C 6: 27,363,190 (GRCm39) E775G probably damaging Het
Hipk3 C T 2: 104,276,916 (GRCm39) V388M probably damaging Het
Ighe T C 12: 113,232,908 (GRCm39) probably benign Het
Kif14 A G 1: 136,453,544 (GRCm39) T1491A probably benign Het
Klre1 A G 6: 129,559,229 (GRCm39) probably null Het
Kpna6 A T 4: 129,547,777 (GRCm39) L257M probably damaging Het
Ldhc G A 7: 46,515,955 (GRCm39) probably null Het
Lekr1 C A 3: 65,591,380 (GRCm39) A39D probably benign Het
Lins1 A G 7: 66,358,230 (GRCm39) T122A probably benign Het
Lrrc40 G A 3: 157,769,350 (GRCm39) R516Q probably benign Het
Meis3 G T 7: 15,916,255 (GRCm39) G72* probably null Het
Mpo A G 11: 87,686,194 (GRCm39) T115A probably damaging Het
Mrgprb5 A G 7: 47,818,537 (GRCm39) V66A probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Nags C A 11: 102,037,347 (GRCm39) A146E probably benign Het
Nkain4 C T 2: 180,585,970 (GRCm39) G31D probably damaging Het
Or2y1 T G 11: 49,385,784 (GRCm39) C141W probably damaging Het
Or4k1 T A 14: 50,377,181 (GRCm39) H305L probably benign Het
Or5ak24 A C 2: 85,260,883 (GRCm39) C97G probably damaging Het
Or8a1 A G 9: 37,641,560 (GRCm39) C240R probably damaging Het
Otud6b C T 4: 14,822,739 (GRCm39) V122I probably benign Het
Ovca2 C T 11: 75,069,569 (GRCm39) S18N possibly damaging Het
Pax2 A G 19: 44,823,916 (GRCm39) S370G unknown Het
Pias2 G A 18: 77,153,416 (GRCm39) probably null Het
Slc2a10 T C 2: 165,357,128 (GRCm39) F263L probably damaging Het
Smarcc2 A G 10: 128,323,638 (GRCm39) probably null Het
Srcap A G 7: 127,134,089 (GRCm39) T937A probably benign Het
Ssh2 C A 11: 77,340,259 (GRCm39) D470E possibly damaging Het
St8sia1 A T 6: 142,775,008 (GRCm39) probably null Het
Supt20 T A 3: 54,606,022 (GRCm39) I36K possibly damaging Het
Tor1aip2 T A 1: 155,941,155 (GRCm39) L487Q probably damaging Het
Zfp619 G T 7: 39,187,322 (GRCm39) K1117N probably damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAGGTAGCCGCTTCCATAG -3'
(R):5'- CATCAGTACTGCTACTTGGTGGTG -3'

Sequencing Primer
(F):5'- CTTCCATAGCGTCCGTTGGG -3'
(R):5'- ACAGTCTGGTGTCCTGCAG -3'
Posted On 2018-07-24