Incidental Mutation 'R6713:Lins1'
ID529213
Institutional Source Beutler Lab
Gene Symbol Lins1
Ensembl Gene ENSMUSG00000053091
Gene Namelines homolog 1
SynonymsWins2, Lins, 2700083B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6713 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location66689889-66717256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66708482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 122 (T122A)
Ref Sequence ENSEMBL: ENSMUSP00000117270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065323] [ENSMUST00000077967] [ENSMUST00000121777] [ENSMUST00000130161] [ENSMUST00000133771] [ENSMUST00000150071] [ENSMUST00000153007] [ENSMUST00000153773]
Predicted Effect probably benign
Transcript: ENSMUST00000065323
AA Change: T122A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000077967
AA Change: T122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077117
Gene: ENSMUSG00000053091
AA Change: T122A

DomainStartEndE-ValueType
Pfam:LINES_N 204 554 1.6e-119 PFAM
low complexity region 641 652 N/A INTRINSIC
low complexity region 684 699 N/A INTRINSIC
Pfam:LINES_C 717 755 5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121777
AA Change: T122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112404
Gene: ENSMUSG00000053091
AA Change: T122A

DomainStartEndE-ValueType
Pfam:LINES_N 210 558 9.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
Pfam:LINES_C 723 759 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128486
Predicted Effect probably benign
Transcript: ENSMUST00000130161
AA Change: T122A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132181
Predicted Effect probably benign
Transcript: ENSMUST00000132351
SMART Domains Protein: ENSMUSP00000115180
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 155 244 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133199
SMART Domains Protein: ENSMUSP00000115124
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 1 220 3.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133771
AA Change: T122A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000150071
Predicted Effect probably benign
Transcript: ENSMUST00000153007
Predicted Effect probably benign
Transcript: ENSMUST00000153773
SMART Domains Protein: ENSMUSP00000119187
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 75 229 1.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Drosophila segment polarity gene lin encodes a protein, lines, which plays important roles in development of the epidermis and hindgut. This gene encodes a protein containing a lines-like domain. This gene is located on chromosome 15 and clustered with the gene encoding ankyrin repeat and SOCS box-containing protein 7. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a C T 15: 77,488,851 T229M possibly damaging Het
Cdh16 G A 8: 104,619,985 Q226* probably null Het
Cemip A T 7: 83,943,637 N1227K probably benign Het
Dusp13 A G 14: 21,748,473 V41A probably damaging Het
F3 C T 3: 121,731,674 T53I possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fyb2 T A 4: 104,990,235 M484K probably benign Het
Glb1l A T 1: 75,202,417 H253Q probably benign Het
Grm8 T C 6: 27,363,191 E775G probably damaging Het
Hipk3 C T 2: 104,446,571 V388M probably damaging Het
Ighe T C 12: 113,269,288 probably benign Het
Kif14 A G 1: 136,525,806 T1491A probably benign Het
Klre1 A G 6: 129,582,266 probably null Het
Kpna6 A T 4: 129,653,984 L257M probably damaging Het
Ldhc G A 7: 46,866,531 probably null Het
Lekr1 C A 3: 65,683,959 A39D probably benign Het
Lrrc40 G A 3: 158,063,713 R516Q probably benign Het
Meis3 G T 7: 16,182,330 G72* probably null Het
Mpo A G 11: 87,795,368 T115A probably damaging Het
Mrgprb5 A G 7: 48,168,789 V66A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nags C A 11: 102,146,521 A146E probably benign Het
Nkain4 C T 2: 180,944,177 G31D probably damaging Het
Olfr1385 T G 11: 49,494,957 C141W probably damaging Het
Olfr151 A G 9: 37,730,264 C240R probably damaging Het
Olfr728 T A 14: 50,139,724 H305L probably benign Het
Olfr994 A C 2: 85,430,539 C97G probably damaging Het
Otud6b C T 4: 14,822,739 V122I probably benign Het
Ovca2 C T 11: 75,178,743 S18N possibly damaging Het
Pax2 A G 19: 44,835,477 S370G unknown Het
Pias2 G A 18: 77,065,720 probably null Het
Slc2a10 T C 2: 165,515,208 F263L probably damaging Het
Slc6a17 T G 3: 107,471,387 M660L probably benign Het
Smarcc2 A G 10: 128,487,769 probably null Het
Srcap A G 7: 127,534,917 T937A probably benign Het
Ssh2 C A 11: 77,449,433 D470E possibly damaging Het
St8sia1 A T 6: 142,829,282 probably null Het
Supt20 T A 3: 54,698,601 I36K possibly damaging Het
Tor1aip2 T A 1: 156,065,409 L487Q probably damaging Het
Zfp619 G T 7: 39,537,898 K1117N probably damaging Het
Other mutations in Lins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lins1 APN 7 66714531 nonsense probably null
IGL01402:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01404:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01887:Lins1 APN 7 66710381 missense probably damaging 0.98
IGL02887:Lins1 APN 7 66714183 missense probably damaging 0.99
R0089:Lins1 UTSW 7 66712048 unclassified probably benign
R1473:Lins1 UTSW 7 66712046 critical splice donor site probably null
R1556:Lins1 UTSW 7 66710637 nonsense probably null
R1580:Lins1 UTSW 7 66714491 missense probably benign 0.10
R1794:Lins1 UTSW 7 66711909 missense probably damaging 1.00
R1848:Lins1 UTSW 7 66714322 missense probably damaging 0.98
R3969:Lins1 UTSW 7 66708198 missense probably benign 0.31
R4760:Lins1 UTSW 7 66714687 unclassified probably benign
R4766:Lins1 UTSW 7 66710641 missense possibly damaging 0.92
R4811:Lins1 UTSW 7 66708150 missense probably benign 0.00
R4941:Lins1 UTSW 7 66709450 splice site probably benign
R5419:Lins1 UTSW 7 66708095 unclassified probably benign
R6140:Lins1 UTSW 7 66711924 missense probably damaging 1.00
R6258:Lins1 UTSW 7 66710748 critical splice donor site probably null
R6787:Lins1 UTSW 7 66714154 missense probably benign 0.32
R7176:Lins1 UTSW 7 66713805 missense probably benign 0.10
R7455:Lins1 UTSW 7 66711944 missense probably benign 0.14
R7761:Lins1 UTSW 7 66714105 nonsense probably null
Z1176:Lins1 UTSW 7 66710264 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGCTCAGTCTAATGCCAGTG -3'
(R):5'- AGCCATGTGGGACAACAAC -3'

Sequencing Primer
(F):5'- CAGTCTAATGCCAGTGGTGTGC -3'
(R):5'- CAACTTGTCAGAATTCTGGAGCATGC -3'
Posted On2018-07-24