Incidental Mutation 'R6713:Cdh16'
ID529216
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6713 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 104619985 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 226 (Q226*)
Ref Sequence ENSEMBL: ENSMUSP00000148726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect probably null
Transcript: ENSMUST00000163783
AA Change: Q196*
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: Q196*

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably null
Transcript: ENSMUST00000211903
AA Change: Q226*
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
Predicted Effect probably null
Transcript: ENSMUST00000212447
AA Change: Q173*
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect probably null
Transcript: ENSMUST00000212882
AA Change: Q226*
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a C T 15: 77,488,851 T229M possibly damaging Het
Cemip A T 7: 83,943,637 N1227K probably benign Het
Dusp13 A G 14: 21,748,473 V41A probably damaging Het
F3 C T 3: 121,731,674 T53I possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fyb2 T A 4: 104,990,235 M484K probably benign Het
Glb1l A T 1: 75,202,417 H253Q probably benign Het
Grm8 T C 6: 27,363,191 E775G probably damaging Het
Hipk3 C T 2: 104,446,571 V388M probably damaging Het
Ighe T C 12: 113,269,288 probably benign Het
Kif14 A G 1: 136,525,806 T1491A probably benign Het
Klre1 A G 6: 129,582,266 probably null Het
Kpna6 A T 4: 129,653,984 L257M probably damaging Het
Ldhc G A 7: 46,866,531 probably null Het
Lekr1 C A 3: 65,683,959 A39D probably benign Het
Lins1 A G 7: 66,708,482 T122A probably benign Het
Lrrc40 G A 3: 158,063,713 R516Q probably benign Het
Meis3 G T 7: 16,182,330 G72* probably null Het
Mpo A G 11: 87,795,368 T115A probably damaging Het
Mrgprb5 A G 7: 48,168,789 V66A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nags C A 11: 102,146,521 A146E probably benign Het
Nkain4 C T 2: 180,944,177 G31D probably damaging Het
Olfr1385 T G 11: 49,494,957 C141W probably damaging Het
Olfr151 A G 9: 37,730,264 C240R probably damaging Het
Olfr728 T A 14: 50,139,724 H305L probably benign Het
Olfr994 A C 2: 85,430,539 C97G probably damaging Het
Otud6b C T 4: 14,822,739 V122I probably benign Het
Ovca2 C T 11: 75,178,743 S18N possibly damaging Het
Pax2 A G 19: 44,835,477 S370G unknown Het
Pias2 G A 18: 77,065,720 probably null Het
Slc2a10 T C 2: 165,515,208 F263L probably damaging Het
Slc6a17 T G 3: 107,471,387 M660L probably benign Het
Smarcc2 A G 10: 128,487,769 probably null Het
Srcap A G 7: 127,534,917 T937A probably benign Het
Ssh2 C A 11: 77,449,433 D470E possibly damaging Het
St8sia1 A T 6: 142,829,282 probably null Het
Supt20 T A 3: 54,698,601 I36K possibly damaging Het
Tor1aip2 T A 1: 156,065,409 L487Q probably damaging Het
Zfp619 G T 7: 39,537,898 K1117N probably damaging Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R0016:Cdh16 UTSW 8 104617632 missense probably benign 0.22
R1233:Cdh16 UTSW 8 104618482 missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1752:Cdh16 UTSW 8 104619873 critical splice donor site probably null
R1892:Cdh16 UTSW 8 104617999 missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 unclassified probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
R7202:Cdh16 UTSW 8 104614148 missense unknown
R7413:Cdh16 UTSW 8 104619940 missense probably benign 0.00
R7460:Cdh16 UTSW 8 104622291 missense possibly damaging 0.88
RF005:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
RF024:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Z1176:Cdh16 UTSW 8 104615185 missense probably damaging 1.00
Z1177:Cdh16 UTSW 8 104623440 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCAAGTTGAGTCCTGGAC -3'
(R):5'- TCCCTCAAAGTCTTTTAAACACCTG -3'

Sequencing Primer
(F):5'- AAGTTGAGTCCTGGACATTCC -3'
(R):5'- AAACACCTGTAATATGCTTGGC -3'
Posted On2018-07-24