Incidental Mutation 'R6713:Dusp13'
ID529225
Institutional Source Beutler Lab
Gene Symbol Dusp13
Ensembl Gene ENSMUSG00000021768
Gene Namedual specificity phosphatase 13
SynonymsTMDP, TS-DSP6, LMW-DSP6, LOC382853
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6713 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location21733394-21751181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21748473 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000120977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022292] [ENSMUST00000075040] [ENSMUST00000119430] [ENSMUST00000127851] [ENSMUST00000144061] [ENSMUST00000153071] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184571] [ENSMUST00000185042]
Predicted Effect probably benign
Transcript: ENSMUST00000022292
SMART Domains Protein: ENSMUSP00000022292
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
SAM 72 141 1.86e-3 SMART
transmembrane domain 215 237 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Pfam:PAP2_C 355 428 3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075040
AA Change: V41A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768
AA Change: V41A

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119430
SMART Domains Protein: ENSMUSP00000112803
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
SAM 9 78 1.86e-3 SMART
transmembrane domain 152 174 N/A INTRINSIC
transmembrane domain 199 221 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Pfam:PAP2_C 292 365 6.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127051
SMART Domains Protein: ENSMUSP00000127910
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 9 142 2.4e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127851
AA Change: V41A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768
AA Change: V41A

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142076
Predicted Effect probably benign
Transcript: ENSMUST00000144061
SMART Domains Protein: ENSMUSP00000117603
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153071
SMART Domains Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
Pfam:DSPc 1 48 5.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183824
Predicted Effect unknown
Transcript: ENSMUST00000183893
AA Change: V41A
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768
AA Change: V41A

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183943
AA Change: V41A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: V41A

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184571
AA Change: V41A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000185042
AA Change: V41A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5864 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a C T 15: 77,488,851 T229M possibly damaging Het
Cdh16 G A 8: 104,619,985 Q226* probably null Het
Cemip A T 7: 83,943,637 N1227K probably benign Het
F3 C T 3: 121,731,674 T53I possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fyb2 T A 4: 104,990,235 M484K probably benign Het
Glb1l A T 1: 75,202,417 H253Q probably benign Het
Grm8 T C 6: 27,363,191 E775G probably damaging Het
Hipk3 C T 2: 104,446,571 V388M probably damaging Het
Ighe T C 12: 113,269,288 probably benign Het
Kif14 A G 1: 136,525,806 T1491A probably benign Het
Klre1 A G 6: 129,582,266 probably null Het
Kpna6 A T 4: 129,653,984 L257M probably damaging Het
Ldhc G A 7: 46,866,531 probably null Het
Lekr1 C A 3: 65,683,959 A39D probably benign Het
Lins1 A G 7: 66,708,482 T122A probably benign Het
Lrrc40 G A 3: 158,063,713 R516Q probably benign Het
Meis3 G T 7: 16,182,330 G72* probably null Het
Mpo A G 11: 87,795,368 T115A probably damaging Het
Mrgprb5 A G 7: 48,168,789 V66A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nags C A 11: 102,146,521 A146E probably benign Het
Nkain4 C T 2: 180,944,177 G31D probably damaging Het
Olfr1385 T G 11: 49,494,957 C141W probably damaging Het
Olfr151 A G 9: 37,730,264 C240R probably damaging Het
Olfr728 T A 14: 50,139,724 H305L probably benign Het
Olfr994 A C 2: 85,430,539 C97G probably damaging Het
Otud6b C T 4: 14,822,739 V122I probably benign Het
Ovca2 C T 11: 75,178,743 S18N possibly damaging Het
Pax2 A G 19: 44,835,477 S370G unknown Het
Pias2 G A 18: 77,065,720 probably null Het
Slc2a10 T C 2: 165,515,208 F263L probably damaging Het
Slc6a17 T G 3: 107,471,387 M660L probably benign Het
Smarcc2 A G 10: 128,487,769 probably null Het
Srcap A G 7: 127,534,917 T937A probably benign Het
Ssh2 C A 11: 77,449,433 D470E possibly damaging Het
St8sia1 A T 6: 142,829,282 probably null Het
Supt20 T A 3: 54,698,601 I36K possibly damaging Het
Tor1aip2 T A 1: 156,065,409 L487Q probably damaging Het
Zfp619 G T 7: 39,537,898 K1117N probably damaging Het
Other mutations in Dusp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13 APN 14 21733839 missense probably damaging 1.00
IGL02963:Dusp13 APN 14 21733807 missense possibly damaging 0.86
R0827:Dusp13 UTSW 14 21742771 missense probably benign
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1882:Dusp13 UTSW 14 21734975 missense probably benign 0.04
R2915:Dusp13 UTSW 14 21740137 missense probably damaging 1.00
R3954:Dusp13 UTSW 14 21740107 missense probably damaging 1.00
R4623:Dusp13 UTSW 14 21743478 unclassified probably benign
R4837:Dusp13 UTSW 14 21743525 utr 3 prime probably benign
R7294:Dusp13 UTSW 14 21733714 missense possibly damaging 0.47
R7782:Dusp13 UTSW 14 21741336 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAATCGCTCCTGGAACTTAGG -3'
(R):5'- GAGTCACTTTGTCCCACCTG -3'

Sequencing Primer
(F):5'- TCCTGGAACTTAGGAGTCAGG -3'
(R):5'- CCAATCTCTGGCAAGGAGAAATAGC -3'
Posted On2018-07-24