Incidental Mutation 'R6714:Bub1'
ID529238
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127814732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 463 (M463I)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably benign
Transcript: ENSMUST00000028858
AA Change: M463I

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: M463I

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably null Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1502:Bub1 UTSW 2 127827419 missense probably damaging 0.98
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2165:Bub1 UTSW 2 127801281 missense probably benign 0.01
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2507:Bub1 UTSW 2 127801423 missense probably benign 0.04
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5591:Bub1 UTSW 2 127819343 missense probably benign 0.16
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R7094:Bub1 UTSW 2 127821761 missense probably null 0.99
Z1176:Bub1 UTSW 2 127829565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAACCTTTTCAAACTGTC -3'
(R):5'- TGGTTCAAGGAACACCATGC -3'

Sequencing Primer
(F):5'- TGGCACACTATTCAAAGCAGG -3'
(R):5'- TTCAAGGAACACCATGCAAAGTG -3'
Posted On2018-07-24