Incidental Mutation 'R6714:Rbm39'
ID529241
Institutional Source Beutler Lab
Gene Symbol Rbm39
Ensembl Gene ENSMUSG00000027620
Gene NameRNA binding motif protein 39
SynonymsB330012G18Rik, Caper alpha, 1500012C14Rik, caper, Rnpc2, 2310040E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156147239-156180238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 156161618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 281 (L281V)
Ref Sequence ENSEMBL: ENSMUSP00000119298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029149] [ENSMUST00000109587] [ENSMUST00000126992] [ENSMUST00000142071] [ENSMUST00000146288] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029149
AA Change: L281V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620
AA Change: L281V

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109587
AA Change: L281V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620
AA Change: L281V

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126992
SMART Domains Protein: ENSMUSP00000116950
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 135 N/A INTRINSIC
RRM 153 225 2.5e-15 SMART
PDB:2JRS|A 239 273 9e-18 PDB
Blast:RRM 250 273 4e-9 BLAST
SCOP:d1l3ka1 250 273 9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135274
Predicted Effect probably benign
Transcript: ENSMUST00000142071
AA Change: L281V

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620
AA Change: L281V

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146288
SMART Domains Protein: ENSMUSP00000114824
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 27 114 N/A INTRINSIC
PDB:2CQ4|A 115 156 2e-21 PDB
Blast:RRM 132 156 1e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000146297
AA Change: L281V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620
AA Change: L281V

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148794
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150272
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous disruption of this locus results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Rbm39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Rbm39 APN 2 156162871 missense probably damaging 1.00
IGL01473:Rbm39 APN 2 156172979 nonsense probably null
R0040:Rbm39 UTSW 2 156148179 missense possibly damaging 0.90
R1564:Rbm39 UTSW 2 156154257 missense probably benign 0.01
R2888:Rbm39 UTSW 2 156167583 missense probably benign 0.01
R4872:Rbm39 UTSW 2 156177346 missense possibly damaging 0.94
R5124:Rbm39 UTSW 2 156159162 missense probably damaging 0.99
R5125:Rbm39 UTSW 2 156162865 missense probably damaging 0.99
R5843:Rbm39 UTSW 2 156162873 missense possibly damaging 0.84
R6820:Rbm39 UTSW 2 156179226 start codon destroyed probably null 0.66
R6970:Rbm39 UTSW 2 156167584 missense probably damaging 1.00
R8178:Rbm39 UTSW 2 156154275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGATCCAGGCAGATGTG -3'
(R):5'- AGGCTCTATGTAGGCTCATTACAC -3'

Sequencing Primer
(F):5'- TCCAGGCAGATGTGACAAAGTTAGAC -3'
(R):5'- CAAAACTCTTAACTGAAGGAGT -3'
Posted On2018-07-24