Incidental Mutation 'R6714:Qrfpr'
ID 529245
Institutional Source Beutler Lab
Gene Symbol Qrfpr
Ensembl Gene ENSMUSG00000058400
Gene Name pyroglutamylated RFamide peptide receptor
Synonyms Gpr103, AQ27
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6714 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36179424-36222313 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36180256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 312 (M312K)
Ref Sequence ENSEMBL: ENSMUSP00000088768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091227] [ENSMUST00000197447]
AlphaFold P83861
Predicted Effect possibly damaging
Transcript: ENSMUST00000091227
AA Change: M312K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088768
Gene: ENSMUSG00000058400
AA Change: M312K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 347 3.6e-8 PFAM
Pfam:7tm_1 62 332 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197447
SMART Domains Protein: ENSMUSP00000143773
Gene: ENSMUSG00000058400

DomainStartEndE-ValueType
low complexity region 40 61 N/A INTRINSIC
Pfam:7tm_1 62 229 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation diisplay kyphosis with abnormal vertebrae morphology and development including osteopenia of the vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Qrfpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Qrfpr APN 3 36181051 splice site probably null
IGL02274:Qrfpr APN 3 36222136 missense probably damaging 0.98
R0382:Qrfpr UTSW 3 36180969 missense possibly damaging 0.73
R0398:Qrfpr UTSW 3 36181052 splice site probably benign
R0631:Qrfpr UTSW 3 36221989 missense probably damaging 1.00
R0690:Qrfpr UTSW 3 36189559 missense probably damaging 1.00
R1222:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1413:Qrfpr UTSW 3 36182660 missense possibly damaging 0.92
R1418:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1500:Qrfpr UTSW 3 36182580 missense probably damaging 1.00
R2037:Qrfpr UTSW 3 36182657 missense probably damaging 0.99
R3924:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3925:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3966:Qrfpr UTSW 3 36181000 missense possibly damaging 0.73
R4298:Qrfpr UTSW 3 36189554 missense probably damaging 1.00
R4751:Qrfpr UTSW 3 36182622 missense possibly damaging 0.67
R4760:Qrfpr UTSW 3 36221924 missense probably benign 0.34
R4989:Qrfpr UTSW 3 36222136 missense probably damaging 0.98
R5548:Qrfpr UTSW 3 36221926 missense possibly damaging 0.84
R5607:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R5608:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R6027:Qrfpr UTSW 3 36222038 missense probably benign 0.44
R6115:Qrfpr UTSW 3 36182593 missense possibly damaging 0.51
R6546:Qrfpr UTSW 3 36180265 missense probably damaging 1.00
R7080:Qrfpr UTSW 3 36180049 missense probably benign 0.04
R7833:Qrfpr UTSW 3 36189602 missense probably benign
R8796:Qrfpr UTSW 3 36180196 missense probably damaging 1.00
R9032:Qrfpr UTSW 3 36221950 missense probably damaging 1.00
R9085:Qrfpr UTSW 3 36221950 missense probably damaging 1.00
R9121:Qrfpr UTSW 3 36181007 missense probably damaging 1.00
R9522:Qrfpr UTSW 3 36182527 missense probably damaging 1.00
Z1176:Qrfpr UTSW 3 36182610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATCCCAGAATTTCCAGGC -3'
(R):5'- AGTTGTGGGTCCAGTAACATACAC -3'

Sequencing Primer
(F):5'- GAAATCCCAGAATTTCCAGGCTTCTG -3'
(R):5'- CGCCACACTGTGTAGGTAAG -3'
Posted On 2018-07-24