Mutagenetix > Incidental Mutation

Incidental Mutation 'R6714:Clspn'

529246

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6714 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126565768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 320 (T320M)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]

AlphaFold

Q80YR7

Predicted Effect

probably damaging
Transcript: ENSMUST00000048391
AA Change: T320M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: T320M

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123695

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129795
AA Change: T151M

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: T151M

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC061237	A	T	14: 44,504,182	R127S	possibly damaging	Het
Bub1	C	A	2: 127,814,732	M463I	probably benign	Het
Cdh23	T	C	10: 60,331,830	I1794V	possibly damaging	Het
Coch	A	C	12: 51,602,737	D277A	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Dnah7c	A	T	1: 46,740,806	I3223F	probably damaging	Het
E2f6	G	A	12: 16,819,002	V109I	probably damaging	Het
Edem2	A	T	2: 155,728,889		probably null	Het
Efcab8	A	G	2: 153,789,210	K187E	probably damaging	Het
Fam184a	T	C	10: 53,698,883	N210S	probably benign	Het
Fam208b	A	T	13: 3,594,189	F143L	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	A	G	2: 82,979,534	I2066V	probably benign	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gm9992	T	G	17: 7,376,538	E124A	probably benign	Het
Gpc5	C	T	14: 115,552,303	Q530*	probably null	Het
Hmcn1	A	T	1: 150,704,175	I1937K	probably damaging	Het
Hpx	G	A	7: 105,595,095	R269C	probably damaging	Het
Ice1	T	C	13: 70,615,263		probably null	Het
Kbtbd4	A	T	2: 90,905,839		probably benign	Het
Ldlrad3	T	C	2: 101,952,952	T310A	probably benign	Het
Lrp4	G	A	2: 91,476,365	S341N	possibly damaging	Het
Map3k3	T	C	11: 106,114,222	V69A	possibly damaging	Het
Myh8	T	C	11: 67,306,949	Y1881H	probably damaging	Het
Nectin4	A	T	1: 171,370,650		probably benign	Het
Nhsl1	G	T	10: 18,524,711	V562L	possibly damaging	Het
Olfr729	A	T	14: 50,148,214	I220K	possibly damaging	Het
Olfr775	T	A	10: 129,250,940	N135K	possibly damaging	Het
Pcdhga7	T	A	18: 37,717,277	V779E	probably benign	Het
Peg12	T	A	7: 62,463,569	H260L	unknown	Het
Qrfpr	A	T	3: 36,180,256	M312K	possibly damaging	Het
Rbl2	T	A	8: 91,106,787	I730N	possibly damaging	Het
Rbm39	G	C	2: 156,161,618	L281V	possibly damaging	Het
Setd1b	A	G	5: 123,157,591	E1074G	unknown	Het
Sfr1	A	G	19: 47,734,966	D303G	probably damaging	Het
Slc7a12	T	C	3: 14,481,320	V175A	probably benign	Het
Slc8a1	A	T	17: 81,408,249	L785Q	probably damaging	Het
Spdl1	T	A	11: 34,823,003		probably null	Het
Spg11	T	C	2: 122,095,731	I694M	probably damaging	Het
Trpc1	A	T	9: 95,723,273	L111Q	probably damaging	Het
Tti1	A	G	2: 158,007,051	V756A	possibly damaging	Het
Usp32	A	T	11: 85,026,870	I777N	probably damaging	Het
Zbtb8b	C	T	4: 129,432,983	E97K	probably damaging	Het
Zfhx4	A	G	3: 5,241,837	D41G	probably damaging	Het
Zfp493	A	T	13: 67,786,380	S151C	probably benign	Het
Zfp503	T	C	14: 21,985,757	T364A	probably benign	Het
Zfp507	T	C	7: 35,787,727	K772R	probably damaging	Het
Zfp804b	T	A	5: 6,769,239	M1275L	probably benign	Het
Zfp811	G	A	17: 32,797,762	H434Y	probably damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACGCAGGACTGTTTTCTGTC -3'
(R):5'- CCCGACTGATACTTACATGACCTAG -3'

Sequencing Primer
(F):5'- CGCAGGACTGTTTTCTGTCTCATG -3'
(R):5'- GGTGGAACTGAAAATTCTCACTGTG -3'

Posted On

2018-07-24