Incidental Mutation 'R6714:Clspn'
ID529246
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Nameclaspin
SynonymsC85083, E130314M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126556935-126593903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126565768 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 320 (T320M)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]
Predicted Effect probably damaging
Transcript: ENSMUST00000048391
AA Change: T320M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: T320M

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123695
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129795
AA Change: T151M

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: T151M

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126573178 missense probably damaging 1.00
IGL02160:Clspn APN 4 126581510 missense probably benign 0.21
IGL02231:Clspn APN 4 126559228 missense probably damaging 0.98
IGL02281:Clspn APN 4 126565770 missense possibly damaging 0.90
IGL02368:Clspn APN 4 126566107 missense probably benign
IGL03149:Clspn APN 4 126576502 splice site probably benign
Durch UTSW 4 126580962 missense probably damaging 0.99
R0012:Clspn UTSW 4 126564929 unclassified probably benign
R0035:Clspn UTSW 4 126565003 splice site probably null
R0035:Clspn UTSW 4 126565003 splice site probably null
R0207:Clspn UTSW 4 126590598 missense possibly damaging 0.82
R0270:Clspn UTSW 4 126573236 missense probably damaging 1.00
R0825:Clspn UTSW 4 126573130 splice site probably benign
R1082:Clspn UTSW 4 126577779 missense possibly damaging 0.95
R1349:Clspn UTSW 4 126563977 missense probably benign
R1568:Clspn UTSW 4 126581517 missense probably benign 0.01
R1649:Clspn UTSW 4 126566435 unclassified probably benign
R1663:Clspn UTSW 4 126565975 missense probably benign 0.00
R2497:Clspn UTSW 4 126572347 missense possibly damaging 0.79
R3107:Clspn UTSW 4 126591659 missense probably benign 0.06
R3951:Clspn UTSW 4 126576379 missense probably damaging 1.00
R3953:Clspn UTSW 4 126566437 frame shift probably null
R3954:Clspn UTSW 4 126566437 frame shift probably null
R3956:Clspn UTSW 4 126566437 frame shift probably null
R4599:Clspn UTSW 4 126581460 missense probably benign 0.14
R4717:Clspn UTSW 4 126560056 missense probably damaging 1.00
R4853:Clspn UTSW 4 126566555 missense probably damaging 0.99
R4854:Clspn UTSW 4 126575950 missense probably benign
R4979:Clspn UTSW 4 126578386 missense probably damaging 1.00
R5363:Clspn UTSW 4 126561786 missense possibly damaging 0.58
R5531:Clspn UTSW 4 126577773 missense probably benign
R5614:Clspn UTSW 4 126580962 missense probably damaging 0.99
R5706:Clspn UTSW 4 126578418 missense probably damaging 1.00
R5806:Clspn UTSW 4 126586106 missense probably damaging 1.00
R6106:Clspn UTSW 4 126590641 missense probably benign 0.00
R6178:Clspn UTSW 4 126577736 splice site probably null
R6223:Clspn UTSW 4 126586168 missense probably damaging 0.99
R6326:Clspn UTSW 4 126565739 missense probably damaging 1.00
R6398:Clspn UTSW 4 126563947 missense probably damaging 1.00
R7003:Clspn UTSW 4 126592720 missense possibly damaging 0.63
R7034:Clspn UTSW 4 126580982 missense possibly damaging 0.87
R7358:Clspn UTSW 4 126566200 missense probably benign 0.02
R7376:Clspn UTSW 4 126590637 missense possibly damaging 0.65
R7675:Clspn UTSW 4 126566320 missense probably benign 0.00
R8320:Clspn UTSW 4 126563950 missense possibly damaging 0.73
R8517:Clspn UTSW 4 126566219 missense probably benign 0.00
T0975:Clspn UTSW 4 126566437 unclassified probably benign
X0014:Clspn UTSW 4 126575943 missense probably damaging 1.00
Z1177:Clspn UTSW 4 126566177 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCAGGACTGTTTTCTGTC -3'
(R):5'- CCCGACTGATACTTACATGACCTAG -3'

Sequencing Primer
(F):5'- CGCAGGACTGTTTTCTGTCTCATG -3'
(R):5'- GGTGGAACTGAAAATTCTCACTGTG -3'
Posted On2018-07-24