Incidental Mutation 'R6714:Setd1b'
ID529249
Institutional Source Beutler Lab
Gene Symbol Setd1b
Ensembl Gene ENSMUSG00000038384
Gene NameSET domain containing 1B
SynonymsKMT2G
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6714 (G1)
Quality Score187.009
Status Validated
Chromosome5
Chromosomal Location123142193-123168629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123157591 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1074 (E1074G)
Ref Sequence ENSEMBL: ENSMUSP00000134461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056053] [ENSMUST00000163030] [ENSMUST00000174836]
Predicted Effect unknown
Transcript: ENSMUST00000056053
AA Change: E1074G
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384
AA Change: E1074G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163030
AA Change: E1074G
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384
AA Change: E1074G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174836
AA Change: E1074G
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384
AA Change: E1074G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Homozygous mutant animals died during organogenesis by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably null Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Setd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Setd1b APN 5 123158747 unclassified probably benign
IGL01453:Setd1b APN 5 123158464 intron probably benign
IGL01637:Setd1b APN 5 123148513 missense unknown
IGL01792:Setd1b APN 5 123157146 missense unknown
IGL01877:Setd1b APN 5 123148448 missense unknown
IGL01906:Setd1b APN 5 123157667 missense unknown
IGL01942:Setd1b APN 5 123163426 missense possibly damaging 0.73
IGL02284:Setd1b APN 5 123163428 missense possibly damaging 0.52
IGL02667:Setd1b APN 5 123157497 missense unknown
IGL02850:Setd1b APN 5 123148589 missense unknown
IGL02864:Setd1b APN 5 123158939 unclassified probably benign
IGL03006:Setd1b APN 5 123148451 missense unknown
IGL03307:Setd1b APN 5 123148671 missense unknown
P0037:Setd1b UTSW 5 123165921 unclassified probably benign
R0282:Setd1b UTSW 5 123161017 unclassified probably benign
R0375:Setd1b UTSW 5 123157437 missense unknown
R0550:Setd1b UTSW 5 123157660 missense unknown
R0607:Setd1b UTSW 5 123159951 unclassified probably benign
R0844:Setd1b UTSW 5 123160685 unclassified probably benign
R0973:Setd1b UTSW 5 123160703 small insertion probably benign
R1119:Setd1b UTSW 5 123147716 missense unknown
R1266:Setd1b UTSW 5 123147841 missense unknown
R1370:Setd1b UTSW 5 123160685 unclassified probably benign
R1416:Setd1b UTSW 5 123160685 unclassified probably benign
R1575:Setd1b UTSW 5 123163147 splice site probably benign
R1862:Setd1b UTSW 5 123147613 missense unknown
R1987:Setd1b UTSW 5 123147706 missense unknown
R4109:Setd1b UTSW 5 123152074 small deletion probably benign
R4399:Setd1b UTSW 5 123161798 unclassified probably benign
R4445:Setd1b UTSW 5 123148104 missense unknown
R4577:Setd1b UTSW 5 123148616 missense unknown
R4604:Setd1b UTSW 5 123152074 small deletion probably benign
R4647:Setd1b UTSW 5 123148112 missense unknown
R4648:Setd1b UTSW 5 123148112 missense unknown
R4675:Setd1b UTSW 5 123160998 unclassified probably benign
R5044:Setd1b UTSW 5 123151866 missense unknown
R5071:Setd1b UTSW 5 123160914 unclassified probably benign
R5220:Setd1b UTSW 5 123143408 missense unknown
R5933:Setd1b UTSW 5 123158752 unclassified probably benign
R6247:Setd1b UTSW 5 123158398 intron probably benign
R6446:Setd1b UTSW 5 123161799 unclassified probably benign
R6907:Setd1b UTSW 5 123163232 unclassified probably benign
R7328:Setd1b UTSW 5 123152379 missense unknown
R7412:Setd1b UTSW 5 123152576 missense unknown
R7486:Setd1b UTSW 5 123163592 missense probably benign 0.03
R7542:Setd1b UTSW 5 123148447 missense unknown
R7555:Setd1b UTSW 5 123157757 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCCCACAGAGTCAGAGC -3'
(R):5'- ATCAATCTGGCCATCGCTG -3'

Sequencing Primer
(F):5'- ACCGGGACATAGCTGATGC -3'
(R):5'- CATCGCTGTCGGCTTCG -3'
Posted On2018-07-24