Incidental Mutation 'R6714:Usp32'
ID 529262
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6714 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85026870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 777 (I777N)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect unknown
Transcript: ENSMUST00000000821
AA Change: I75N
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: I75N

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: I777N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I777N

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTGGGTATTTAGGCTACACTTAGTG -3'
(R):5'- ACAGGTAATCTTTGGACCCAC -3'

Sequencing Primer
(F):5'- CTTACCCGGAGCTTTAAG -3'
(R):5'- GGACCCACCAGCAGTTTTC -3'
Posted On 2018-07-24