Incidental Mutation 'R6714:Usp32'
ID529262
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85026870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 777 (I777N)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect unknown
Transcript: ENSMUST00000000821
AA Change: I75N
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: I75N

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: I777N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I777N

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTGGGTATTTAGGCTACACTTAGTG -3'
(R):5'- ACAGGTAATCTTTGGACCCAC -3'

Sequencing Primer
(F):5'- CTTACCCGGAGCTTTAAG -3'
(R):5'- GGACCCACCAGCAGTTTTC -3'
Posted On2018-07-24