Incidental Mutation 'R6714:E2f6'
ID529264
Institutional Source Beutler Lab
Gene Symbol E2f6
Ensembl Gene ENSMUSG00000057469
Gene NameE2F transcription factor 6
SynonymsEMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16810963-16839742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16819002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 109 (V109I)
Ref Sequence ENSEMBL: ENSMUSP00000020908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020908] [ENSMUST00000220794] [ENSMUST00000221541] [ENSMUST00000221934]
Predicted Effect probably damaging
Transcript: ENSMUST00000020908
AA Change: V109I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020908
Gene: ENSMUSG00000057469
AA Change: V109I

DomainStartEndE-ValueType
E2F_TDP 63 128 2.04e-31 SMART
Pfam:E2F_CC-MB 143 237 8.2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220707
Predicted Effect probably benign
Transcript: ENSMUST00000220794
Predicted Effect probably benign
Transcript: ENSMUST00000221541
Predicted Effect probably benign
Transcript: ENSMUST00000221934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222582
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Both homozygous and heterozygous null mice exhibit subtle posterior transformations of the axial skeleton with incomplete penetrance. In addition to skeletal transformations, male mice homozygous for one knock-out allele display defective spermatocyte development and Leydig cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably benign Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in E2f6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:E2f6 APN 12 16825368 missense probably benign 0.23
IGL01985:E2f6 APN 12 16819063 splice site probably null
IGL03162:E2f6 APN 12 16818908 missense probably benign 0.03
IGL03206:E2f6 APN 12 16822089 splice site probably benign
BB007:E2f6 UTSW 12 16819057 missense probably damaging 0.98
BB017:E2f6 UTSW 12 16819057 missense probably damaging 0.98
R0437:E2f6 UTSW 12 16816445 missense probably benign 0.04
R1830:E2f6 UTSW 12 16818883 missense probably benign 0.00
R1898:E2f6 UTSW 12 16824580 missense probably benign 0.01
R5536:E2f6 UTSW 12 16824684 missense probably benign 0.34
R5564:E2f6 UTSW 12 16824705 missense probably benign
R7522:E2f6 UTSW 12 16822124 missense probably benign
R7794:E2f6 UTSW 12 16820369 missense possibly damaging 0.87
R7930:E2f6 UTSW 12 16819057 missense probably damaging 0.98
Z1176:E2f6 UTSW 12 16820273 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATGTCGGTTCACATGGTCCTC -3'
(R):5'- TTAAGTACACCGTGAGACGAG -3'

Sequencing Primer
(F):5'- GGTCCTCTGCCCTCATTTACAGAAG -3'
(R):5'- CAACCTTAAGGAATCAATTTTGGCC -3'
Posted On2018-07-24