Mutagenetix > Incidental Mutations

Incidental Mutation 'R6715:Mtor'

529286

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6715 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148538547 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1999 (C1999R)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: C1999R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: C1999R

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158456

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	G	A	12: 88,459,080	R426H	probably damaging	Het
Arl2	G	A	19: 6,137,525	R98C	probably damaging	Het
Atm	A	G	9: 53,531,648	I105T	probably damaging	Het
Cnnm2	G	A	19: 46,853,973	G565E	probably damaging	Het
D430042O09Rik	C	T	7: 125,761,829	Q104*	probably null	Het
Ddx60	G	A	8: 61,983,890	G958D	probably benign	Het
Fbxo2	T	A	4: 148,165,769	M252K	probably benign	Het
Filip1	C	A	9: 79,818,758	A860S	probably benign	Het
Gm11992	C	A	11: 9,061,214	S218R	probably damaging	Het
Gnb3	A	G	6: 124,837,728	L69P	possibly damaging	Het
Gpr18	T	G	14: 121,911,977	H212P	possibly damaging	Het
Iqcb1	T	C	16: 36,835,629	F126S	probably damaging	Het
Kcnh1	A	G	1: 192,337,641	D425G	probably benign	Het
Kdm5b	T	A	1: 134,609,061		probably null	Het
Mcm3ap	C	T	10: 76,489,532	T989M	possibly damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Myof	A	T	19: 37,968,346	D508E	probably benign	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr663	G	A	7: 104,703,956	V130M	possibly damaging	Het
Olfr691	A	T	7: 105,337,332	I128N	probably damaging	Het
Osbpl7	A	G	11: 97,054,599	H266R	probably damaging	Het
Pear1	T	C	3: 87,759,117	Y93C	probably damaging	Het
Pgr	A	G	9: 8,964,999	H881R	possibly damaging	Het
Rfx1	A	G	8: 84,095,815	E914G	possibly damaging	Het
Samm50	T	C	15: 84,211,058	I415T	probably benign	Het
Snx7	T	C	3: 117,782,336	D434G	possibly damaging	Het
Susd4	G	A	1: 182,892,037	V406M	probably benign	Het
Syt15	G	T	14: 34,222,862	G122V	probably damaging	Het
Tlr5	A	G	1: 182,972,659		probably benign	Het
Ttc6	T	C	12: 57,674,770		probably null	Het
Vmn1r211	C	A	13: 22,851,779	M239I	probably benign	Het
Vps37a	G	T	8: 40,540,861		probably null	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	unclassified	probably null
motor	UTSW	4	148491360	missense	possibly damaging	0.76
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148526046	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148539999	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4942:Mtor	UTSW	4	148472142	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	unclassified	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148538276	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7737:Mtor	UTSW	4	148538738	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TACATGCAGACCCTGAGCAG -3'
(R):5'- TTCATGCCACATCTCATGCCAG -3'

Sequencing Primer
(F):5'- CTGAGCAGCTTCTCGTGAGTC -3'
(R):5'- CTTCACTCACCTGGATTAAAGGGAG -3'

Posted On

2018-07-24