Mutagenetix > Incidental Mutations

Incidental Mutation 'R6715:Mcm3ap'

529297

Institutional Source

Beutler Lab

Gene Symbol

Mcm3ap

Ensembl Gene

ENSMUSG00000001150

Gene Name

minichromosome maintenance complex component 3 associated protein

Synonyms

GANP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6715 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76468927-76515857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76489532 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 989 (T989M)

Ref Sequence

ENSEMBL: ENSMUSP00000125960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170795]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170795
AA Change: T989M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: T989M

Domain	Start	End	E-Value	Type
Pfam:NupH_GANP	2	286	3.3e-108	PFAM
low complexity region	389	403	N/A	INTRINSIC
Blast:RRM	430	504	5e-39	BLAST
SCOP:d1fjeb2	434	500	6e-4	SMART
low complexity region	544	559	N/A	INTRINSIC
low complexity region	570	586	N/A	INTRINSIC
Pfam:SAC3_GANP	677	903	1.7e-82	PFAM
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1024	1035	N/A	INTRINSIC
low complexity region	1039	1053	N/A	INTRINSIC
low complexity region	1091	1110	N/A	INTRINSIC
low complexity region	1133	1155	N/A	INTRINSIC
Pfam:CID_GANP	1156	1226	1.6e-33	PFAM
Pfam:MCM3AP_GANP	1254	1967	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218881

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	G	A	12: 88,459,080	R426H	probably damaging	Het
Arl2	G	A	19: 6,137,525	R98C	probably damaging	Het
Atm	A	G	9: 53,531,648	I105T	probably damaging	Het
Cnnm2	G	A	19: 46,853,973	G565E	probably damaging	Het
D430042O09Rik	C	T	7: 125,761,829	Q104*	probably null	Het
Ddx60	G	A	8: 61,983,890	G958D	probably benign	Het
Fbxo2	T	A	4: 148,165,769	M252K	probably benign	Het
Filip1	C	A	9: 79,818,758	A860S	probably benign	Het
Gm11992	C	A	11: 9,061,214	S218R	probably damaging	Het
Gnb3	A	G	6: 124,837,728	L69P	possibly damaging	Het
Gpr18	T	G	14: 121,911,977	H212P	possibly damaging	Het
Iqcb1	T	C	16: 36,835,629	F126S	probably damaging	Het
Kcnh1	A	G	1: 192,337,641	D425G	probably benign	Het
Kdm5b	T	A	1: 134,609,061		probably null	Het
Mtor	T	C	4: 148,538,547	C1999R	probably benign	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Myof	A	T	19: 37,968,346	D508E	probably benign	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr663	G	A	7: 104,703,956	V130M	possibly damaging	Het
Olfr691	A	T	7: 105,337,332	I128N	probably damaging	Het
Osbpl7	A	G	11: 97,054,599	H266R	probably damaging	Het
Pear1	T	C	3: 87,759,117	Y93C	probably damaging	Het
Pgr	A	G	9: 8,964,999	H881R	possibly damaging	Het
Rfx1	A	G	8: 84,095,815	E914G	possibly damaging	Het
Samm50	T	C	15: 84,211,058	I415T	probably benign	Het
Snx7	T	C	3: 117,782,336	D434G	possibly damaging	Het
Susd4	G	A	1: 182,892,037	V406M	probably benign	Het
Syt15	G	T	14: 34,222,862	G122V	probably damaging	Het
Tlr5	A	G	1: 182,972,659		probably benign	Het
Ttc6	T	C	12: 57,674,770		probably null	Het
Vmn1r211	C	A	13: 22,851,779	M239I	probably benign	Het
Vps37a	G	T	8: 40,540,861		probably null	Het

Other mutations in Mcm3ap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Mcm3ap	APN	10	76471177	missense	probably benign	0.01
IGL00742:Mcm3ap	APN	10	76492935	missense	probably damaging	1.00
IGL00898:Mcm3ap	APN	10	76470325	missense	probably benign	0.00
IGL00984:Mcm3ap	APN	10	76499566	missense	probably damaging	1.00
IGL01591:Mcm3ap	APN	10	76470805	missense	probably benign
IGL01882:Mcm3ap	APN	10	76483184	missense	possibly damaging	0.71
IGL01973:Mcm3ap	APN	10	76471117	missense	probably benign	0.00
IGL02253:Mcm3ap	APN	10	76470065	missense	probably benign	0.40
IGL02304:Mcm3ap	APN	10	76484738	missense	possibly damaging	0.65
IGL02340:Mcm3ap	APN	10	76496552	nonsense	probably null
IGL02487:Mcm3ap	APN	10	76507555	unclassified	probably benign
IGL02488:Mcm3ap	APN	10	76499649	missense	probably damaging	1.00
IGL02640:Mcm3ap	APN	10	76506421	missense	probably damaging	1.00
IGL02714:Mcm3ap	APN	10	76511033	missense	probably benign	0.00
IGL02748:Mcm3ap	APN	10	76501248	missense	probably damaging	1.00
IGL02894:Mcm3ap	APN	10	76477767	missense	probably benign	0.00
IGL02903:Mcm3ap	APN	10	76471258	splice site	probably benign
IGL02955:Mcm3ap	APN	10	76507466	missense	probably benign	0.34
IGL02989:Mcm3ap	APN	10	76471060	missense	possibly damaging	0.48
IGL03003:Mcm3ap	APN	10	76504697	missense	probably benign	0.01
IGL03081:Mcm3ap	APN	10	76470316	missense	possibly damaging	0.86
IGL03218:Mcm3ap	APN	10	76482733	missense	probably damaging	1.00
IGL03401:Mcm3ap	APN	10	76484649	splice site	probably benign
Doom	UTSW	10	76501314	missense	probably benign
woeful	UTSW	10	76481015	missense	probably benign	0.44
PIT4377001:Mcm3ap	UTSW	10	76502762	missense	possibly damaging	0.78
PIT4791001:Mcm3ap	UTSW	10	76506473	missense	probably damaging	1.00
R0105:Mcm3ap	UTSW	10	76499534	missense	probably damaging	1.00
R0144:Mcm3ap	UTSW	10	76481015	missense	probably benign	0.44
R0423:Mcm3ap	UTSW	10	76502705	missense	probably benign	0.00
R0692:Mcm3ap	UTSW	10	76483169	missense	probably damaging	1.00
R1402:Mcm3ap	UTSW	10	76477914	unclassified	probably benign
R1441:Mcm3ap	UTSW	10	76471166	missense	probably benign
R1512:Mcm3ap	UTSW	10	76470513	missense	probably damaging	1.00
R1533:Mcm3ap	UTSW	10	76504287	missense	probably damaging	1.00
R1569:Mcm3ap	UTSW	10	76483188	missense	possibly damaging	0.80
R1590:Mcm3ap	UTSW	10	76496541	missense	probably benign	0.36
R1597:Mcm3ap	UTSW	10	76483226	missense	probably damaging	1.00
R1743:Mcm3ap	UTSW	10	76484674	missense	possibly damaging	0.53
R1773:Mcm3ap	UTSW	10	76471160	missense	probably benign
R1922:Mcm3ap	UTSW	10	76507361	missense	probably damaging	1.00
R2061:Mcm3ap	UTSW	10	76470068	missense	probably benign	0.43
R2097:Mcm3ap	UTSW	10	76512489	missense	probably damaging	1.00
R2436:Mcm3ap	UTSW	10	76490057	missense	probably damaging	1.00
R3684:Mcm3ap	UTSW	10	76489426	missense	possibly damaging	0.64
R3690:Mcm3ap	UTSW	10	76482679	missense	probably damaging	1.00
R3881:Mcm3ap	UTSW	10	76506446	missense	probably benign	0.21
R4296:Mcm3ap	UTSW	10	76507337	missense	probably damaging	1.00
R4677:Mcm3ap	UTSW	10	76470570	missense	probably damaging	1.00
R4786:Mcm3ap	UTSW	10	76488466	missense	probably benign	0.00
R4882:Mcm3ap	UTSW	10	76484661	nonsense	probably null
R4907:Mcm3ap	UTSW	10	76493441	missense	probably damaging	1.00
R5108:Mcm3ap	UTSW	10	76502702	missense	probably benign	0.04
R5279:Mcm3ap	UTSW	10	76507539	missense	probably damaging	0.96
R5316:Mcm3ap	UTSW	10	76470926	missense	possibly damaging	0.89
R5402:Mcm3ap	UTSW	10	76483314	missense	probably benign	0.04
R5459:Mcm3ap	UTSW	10	76496482	nonsense	probably null
R5473:Mcm3ap	UTSW	10	76502759	missense	probably damaging	1.00
R5570:Mcm3ap	UTSW	10	76481096	missense	possibly damaging	0.89
R5931:Mcm3ap	UTSW	10	76471166	missense	probably benign
R5939:Mcm3ap	UTSW	10	76508361	missense	probably benign	0.00
R5950:Mcm3ap	UTSW	10	76488419	missense	possibly damaging	0.46
R5998:Mcm3ap	UTSW	10	76481142	critical splice donor site	probably null
R6122:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R6192:Mcm3ap	UTSW	10	76501100	missense	probably damaging	0.97
R6226:Mcm3ap	UTSW	10	76515706	missense	possibly damaging	0.95
R6293:Mcm3ap	UTSW	10	76471478	nonsense	probably null
R6669:Mcm3ap	UTSW	10	76507337	missense	probably damaging	0.98
R6759:Mcm3ap	UTSW	10	76501314	missense	probably benign
R6864:Mcm3ap	UTSW	10	76507479	missense	probably damaging	1.00
R6870:Mcm3ap	UTSW	10	76470215	missense	probably benign	0.00
R6935:Mcm3ap	UTSW	10	76504253	missense	possibly damaging	0.84
R6947:Mcm3ap	UTSW	10	76515666	missense	probably benign	0.09
R7212:Mcm3ap	UTSW	10	76501311	missense	probably benign	0.01
R7403:Mcm3ap	UTSW	10	76482823	critical splice donor site	probably null
R7470:Mcm3ap	UTSW	10	76508397	missense	probably damaging	1.00
R7561:Mcm3ap	UTSW	10	76492878	missense	possibly damaging	0.94
R7610:Mcm3ap	UTSW	10	76496720	splice site	probably null
R7620:Mcm3ap	UTSW	10	76470433	missense	probably benign	0.00
R7898:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R8266:Mcm3ap	UTSW	10	76476580	nonsense	probably null
R8367:Mcm3ap	UTSW	10	76477859	missense	possibly damaging	0.65
X0026:Mcm3ap	UTSW	10	76482785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGACTACTTGCTGTGCTC -3'
(R):5'- ACAAGCTCTAACAGGGGCTTC -3'

Sequencing Primer
(F):5'- AATCGGTCGGCATTCTTGGAAC -3'
(R):5'- GGGGCTTCAAAACTCCAGATC -3'

Posted On

2018-07-24