Incidental Mutation 'R6715:Gm11992'
ID529298
Institutional Source Beutler Lab
Gene Symbol Gm11992
Ensembl Gene ENSMUSG00000040978
Gene Namepredicted gene 11992
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6715 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location9048594-9069356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9061214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 218 (S218R)
Ref Sequence ENSEMBL: ENSMUSP00000039806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043285]
Predicted Effect probably damaging
Transcript: ENSMUST00000043285
AA Change: S218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039806
Gene: ENSMUSG00000040978
AA Change: S218R

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Meta Mutation Damage Score 0.1122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 G A 12: 88,459,080 R426H probably damaging Het
Arl2 G A 19: 6,137,525 R98C probably damaging Het
Atm A G 9: 53,531,648 I105T probably damaging Het
Cnnm2 G A 19: 46,853,973 G565E probably damaging Het
D430042O09Rik C T 7: 125,761,829 Q104* probably null Het
Ddx60 G A 8: 61,983,890 G958D probably benign Het
Fbxo2 T A 4: 148,165,769 M252K probably benign Het
Filip1 C A 9: 79,818,758 A860S probably benign Het
Gnb3 A G 6: 124,837,728 L69P possibly damaging Het
Gpr18 T G 14: 121,911,977 H212P possibly damaging Het
Iqcb1 T C 16: 36,835,629 F126S probably damaging Het
Kcnh1 A G 1: 192,337,641 D425G probably benign Het
Kdm5b T A 1: 134,609,061 probably null Het
Mcm3ap C T 10: 76,489,532 T989M possibly damaging Het
Mtor T C 4: 148,538,547 C1999R probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myof A T 19: 37,968,346 D508E probably benign Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr663 G A 7: 104,703,956 V130M possibly damaging Het
Olfr691 A T 7: 105,337,332 I128N probably damaging Het
Osbpl7 A G 11: 97,054,599 H266R probably damaging Het
Pear1 T C 3: 87,759,117 Y93C probably damaging Het
Pgr A G 9: 8,964,999 H881R possibly damaging Het
Rfx1 A G 8: 84,095,815 E914G possibly damaging Het
Samm50 T C 15: 84,211,058 I415T probably benign Het
Snx7 T C 3: 117,782,336 D434G possibly damaging Het
Susd4 G A 1: 182,892,037 V406M probably benign Het
Syt15 G T 14: 34,222,862 G122V probably damaging Het
Tlr5 A G 1: 182,972,659 probably benign Het
Ttc6 T C 12: 57,674,770 probably null Het
Vmn1r211 C A 13: 22,851,779 M239I probably benign Het
Vps37a G T 8: 40,540,861 probably null Het
Other mutations in Gm11992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gm11992 APN 11 9068383 makesense probably null
IGL01837:Gm11992 APN 11 9061266 missense probably damaging 1.00
IGL02405:Gm11992 APN 11 9059939 missense probably benign 0.00
IGL02875:Gm11992 APN 11 9052887 unclassified probably benign
P0023:Gm11992 UTSW 11 9052846 missense probably damaging 1.00
R5100:Gm11992 UTSW 11 9061290 missense probably damaging 0.99
R5471:Gm11992 UTSW 11 9068333 critical splice acceptor site probably null
R5935:Gm11992 UTSW 11 9052711 missense probably damaging 1.00
R7559:Gm11992 UTSW 11 9052747 missense possibly damaging 0.94
R7910:Gm11992 UTSW 11 9049165 missense probably damaging 1.00
R7991:Gm11992 UTSW 11 9049165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATCTTTATGTTAGAAATGGGG -3'
(R):5'- GAGTTTTCTCAGAGCCTTCAGG -3'

Sequencing Primer
(F):5'- CTCACCTGAGACTGAGAGAGG -3'
(R):5'- AGCCTTCAGGGGTCTCTG -3'
Posted On2018-07-24