Mutagenetix > Incidental Mutations

Incidental Mutation 'R6715:Samm50'

529306

Institutional Source

Beutler Lab

Gene Symbol

Samm50

Ensembl Gene

ENSMUSG00000022437

Gene Name

SAMM50 sorting and assembly machinery component

Synonyms

1110030L07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R6715 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84192241-84217267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84211058 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 415 (I415T)

Ref Sequence

ENSEMBL: ENSMUSP00000023071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023071]

Predicted Effect

probably benign
Transcript: ENSMUST00000023071
AA Change: I415T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: I415T

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
Pfam:Bac_surface_Ag	151	468	1.8e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230498

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230659

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	G	A	12: 88,459,080	R426H	probably damaging	Het
Arl2	G	A	19: 6,137,525	R98C	probably damaging	Het
Atm	A	G	9: 53,531,648	I105T	probably damaging	Het
Cnnm2	G	A	19: 46,853,973	G565E	probably damaging	Het
D430042O09Rik	C	T	7: 125,761,829	Q104*	probably null	Het
Ddx60	G	A	8: 61,983,890	G958D	probably benign	Het
Fbxo2	T	A	4: 148,165,769	M252K	probably benign	Het
Filip1	C	A	9: 79,818,758	A860S	probably benign	Het
Gm11992	C	A	11: 9,061,214	S218R	probably damaging	Het
Gnb3	A	G	6: 124,837,728	L69P	possibly damaging	Het
Gpr18	T	G	14: 121,911,977	H212P	possibly damaging	Het
Iqcb1	T	C	16: 36,835,629	F126S	probably damaging	Het
Kcnh1	A	G	1: 192,337,641	D425G	probably benign	Het
Kdm5b	T	A	1: 134,609,061		probably null	Het
Mcm3ap	C	T	10: 76,489,532	T989M	possibly damaging	Het
Mtor	T	C	4: 148,538,547	C1999R	probably benign	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Myof	A	T	19: 37,968,346	D508E	probably benign	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr663	G	A	7: 104,703,956	V130M	possibly damaging	Het
Olfr691	A	T	7: 105,337,332	I128N	probably damaging	Het
Osbpl7	A	G	11: 97,054,599	H266R	probably damaging	Het
Pear1	T	C	3: 87,759,117	Y93C	probably damaging	Het
Pgr	A	G	9: 8,964,999	H881R	possibly damaging	Het
Rfx1	A	G	8: 84,095,815	E914G	possibly damaging	Het
Snx7	T	C	3: 117,782,336	D434G	possibly damaging	Het
Susd4	G	A	1: 182,892,037	V406M	probably benign	Het
Syt15	G	T	14: 34,222,862	G122V	probably damaging	Het
Tlr5	A	G	1: 182,972,659		probably benign	Het
Ttc6	T	C	12: 57,674,770		probably null	Het
Vmn1r211	C	A	13: 22,851,779	M239I	probably benign	Het
Vps37a	G	T	8: 40,540,861		probably null	Het

Other mutations in Samm50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Samm50	APN	15	84200375	missense	possibly damaging	0.82
IGL01061:Samm50	APN	15	84202254	missense	probably benign	0.00
IGL01549:Samm50	APN	15	84202781	missense	probably benign
IGL01586:Samm50	APN	15	84195838	missense	probably benign	0.03
IGL02494:Samm50	APN	15	84195814	missense	probably benign
IGL02607:Samm50	APN	15	84207838	missense	probably benign	0.09
IGL03244:Samm50	APN	15	84214140	missense	probably benign	0.09
IGL03340:Samm50	APN	15	84198663	critical splice donor site	probably null
R0591:Samm50	UTSW	15	84211168	missense	probably benign
R0634:Samm50	UTSW	15	84214171	synonymous	silent
R1780:Samm50	UTSW	15	84211127	missense	probably damaging	0.99
R2192:Samm50	UTSW	15	84200424	critical splice donor site	probably null
R2205:Samm50	UTSW	15	84202314	missense	probably benign	0.01
R3800:Samm50	UTSW	15	84192374	missense	probably damaging	0.99
R4285:Samm50	UTSW	15	84197012	missense	probably damaging	1.00
R4333:Samm50	UTSW	15	84202830	missense	probably benign	0.02
R4780:Samm50	UTSW	15	84210610	missense	possibly damaging	0.88
R5223:Samm50	UTSW	15	84200630	missense	probably benign	0.07
R5639:Samm50	UTSW	15	84214128	missense	probably benign	0.22
R6258:Samm50	UTSW	15	84200311	missense	probably damaging	1.00
R6258:Samm50	UTSW	15	84200312	missense	probably damaging	0.98
R6437:Samm50	UTSW	15	84204097	critical splice donor site	probably null
R6452:Samm50	UTSW	15	84204097	critical splice donor site	probably benign
R6957:Samm50	UTSW	15	84198649	missense	probably damaging	1.00
R7409:Samm50	UTSW	15	84197030	missense	probably benign	0.32
R7459:Samm50	UTSW	15	84195856	critical splice donor site	probably null
R7910:Samm50	UTSW	15	84214145	missense	possibly damaging	0.49
R7991:Samm50	UTSW	15	84214145	missense	possibly damaging	0.49
X0067:Samm50	UTSW	15	84202833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTCCAGAGGATGCTCACAG -3'
(R):5'- TTGCAACAGAAGCTCCGATG -3'

Sequencing Primer
(F):5'- CGCTGCTCTGCTAGAAGAG -3'
(R):5'- TCCGATGAGCTGCAGAGC -3'

Posted On

2018-07-24