Incidental Mutation 'R6313:Sntg1'
ID529311
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Namesyntrophin, gamma 1
SynonymsSYN4, G1SYN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location8361475-9299878 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 8445024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115484
SMART Domains Protein: ENSMUSP00000111147
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PH 9 117 7.66e-1 SMART
low complexity region 165 174 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115488
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132064
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135046
SMART Domains Protein: ENSMUSP00000119420
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:PH 24 86 3e-40 BLAST
low complexity region 98 107 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140295
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191683
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8595410 critical splice donor site probably null
IGL01536:Sntg1 APN 1 8583200 splice site probably null
IGL01558:Sntg1 APN 1 8463388 splice site probably benign
IGL01649:Sntg1 APN 1 8681969 splice site probably benign
IGL02230:Sntg1 APN 1 8681971 critical splice donor site probably null
IGL02252:Sntg1 APN 1 8414228 missense probably benign 0.00
IGL02804:Sntg1 APN 1 8803958 utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8445104 missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8463414 missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8463462 missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8679062 splice site probably benign
R0379:Sntg1 UTSW 1 8782824 missense probably damaging 1.00
R0551:Sntg1 UTSW 1 8554736 missense possibly damaging 0.73
R1081:Sntg1 UTSW 1 8445119 missense possibly damaging 0.92
R1645:Sntg1 UTSW 1 8803931 missense probably benign 0.06
R2089:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R3951:Sntg1 UTSW 1 8782901 splice site probably benign
R4152:Sntg1 UTSW 1 8583345 splice site probably null
R4153:Sntg1 UTSW 1 8583345 splice site probably null
R4154:Sntg1 UTSW 1 8583345 splice site probably null
R4847:Sntg1 UTSW 1 8595482 missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8363594 missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8782798 missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8363439 utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8595533 missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8624784 missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8414271 missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8463443 missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8414270 missense probably benign 0.00
R6075:Sntg1 UTSW 1 8679114 makesense probably null
R6266:Sntg1 UTSW 1 8554729 missense possibly damaging 0.56
R6345:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8363528 utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8445050 missense probably benign 0.16
R7112:Sntg1 UTSW 1 8448065 missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8682019 missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8448065 missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8445025 critical splice donor site probably null
R7892:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R7961:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
R7968:Sntg1 UTSW 1 8465536 nonsense probably null
R8009:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
X0026:Sntg1 UTSW 1 8414247 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGAGTGGCATGAAATTACTTTGC -3'
(R):5'- GACGACCAGATATAACAATGTGTTAGG -3'

Sequencing Primer
(F):5'- GCTATAATTGCTTGCATGAACATTG -3'
(R):5'- GTGGATCAAACCTAGGGTCTTACTC -3'
Posted On2018-07-27