Incidental Mutation 'R6313:Hc'
ID 529312
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms C5, Hfib2, He, C5a
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R6313 (G1)
Quality Score 182.009
Status Validated
Chromosome 2
Chromosomal Location 34873343-34951450 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 34879851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156049
Predicted Effect probably null
Transcript: ENSMUST00000156412
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,126,344 (GRCm39) F1167L probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Acaca C T 11: 84,183,755 (GRCm39) T32I probably benign Het
Adam6a A T 12: 113,508,670 (GRCm39) N348Y possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgef38 T C 3: 132,940,469 (GRCm39) D39G possibly damaging Het
Arid5b T C 10: 67,933,412 (GRCm39) D587G possibly damaging Het
Brwd1 A G 16: 95,809,141 (GRCm39) V1963A probably benign Het
Ccdc136 T A 6: 29,410,204 (GRCm39) L34Q probably damaging Het
Cdh2 T C 18: 16,907,579 (GRCm39) Q53R probably benign Het
Celsr2 G A 3: 108,308,530 (GRCm39) S1799L probably damaging Het
Cenpe A G 3: 134,935,936 (GRCm39) E457G probably benign Het
Cmtm1 A T 8: 105,031,795 (GRCm39) M283K possibly damaging Het
Dcdc5 T C 2: 106,198,516 (GRCm39) noncoding transcript Het
Decr1 T A 4: 15,924,261 (GRCm39) M220L probably benign Het
Dgkg T G 16: 22,338,311 (GRCm39) D592A probably damaging Het
Dkkl1 T C 7: 44,860,862 (GRCm39) Q39R probably benign Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
Efcab2 A T 1: 178,308,936 (GRCm39) E146D probably benign Het
Efhc1 T C 1: 21,049,652 (GRCm39) V504A possibly damaging Het
Ermard T G 17: 15,273,467 (GRCm39) probably null Het
Espl1 T C 15: 102,224,247 (GRCm39) V1266A probably benign Het
Fbxw22 A C 9: 109,232,465 (GRCm39) V40G probably damaging Het
Gm3629 A T 14: 17,834,409 (GRCm39) I194N possibly damaging Het
Gnai2 C T 9: 107,497,296 (GRCm39) V33M possibly damaging Het
H2-DMb1 T C 17: 34,376,506 (GRCm39) probably null Het
Iars1 T C 13: 49,861,921 (GRCm39) S491P probably damaging Het
Knl1 T A 2: 118,899,799 (GRCm39) L500H probably damaging Het
Lamb1 A T 12: 31,319,146 (GRCm39) T102S probably damaging Het
Lrrc7 A G 3: 157,866,373 (GRCm39) S1123P probably damaging Het
Mettl5 C A 2: 69,702,071 (GRCm39) probably null Het
Mmp11 A G 10: 75,759,818 (GRCm39) *4R probably null Het
Myom1 A T 17: 71,389,483 (GRCm39) D911V probably benign Het
Nid1 A G 13: 13,638,367 (GRCm39) T96A probably benign Het
Nlrp4e G T 7: 23,052,597 (GRCm39) V839L probably benign Het
Notch3 A T 17: 32,370,128 (GRCm39) probably null Het
Or8k35 T C 2: 86,424,411 (GRCm39) T254A possibly damaging Het
Pcdh8 T C 14: 80,005,091 (GRCm39) H978R probably benign Het
Pde8b A T 13: 95,178,508 (GRCm39) C537* probably null Het
Polr1b T C 2: 128,967,366 (GRCm39) F920L probably damaging Het
Polr2f A G 15: 79,035,573 (GRCm39) T87A probably damaging Het
Pon2 T A 6: 5,272,421 (GRCm39) H133L probably damaging Het
Pou2af2 C T 9: 51,201,481 (GRCm39) D192N probably damaging Het
Ptk2b T A 14: 66,416,280 (GRCm39) E205V probably damaging Het
Rb1cc1 T A 1: 6,314,357 (GRCm39) M343K probably benign Het
Rlf G A 4: 121,005,807 (GRCm39) R1058W probably damaging Het
S100z T A 13: 95,615,082 (GRCm39) K28* probably null Het
Scarf1 T A 11: 75,411,141 (GRCm39) N273K probably benign Het
Setd2 A G 9: 110,385,434 (GRCm39) I136M unknown Het
Sfrp2 A G 3: 83,674,291 (GRCm39) D148G probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Slc2a9 T G 5: 38,610,464 (GRCm39) I112L probably benign Het
Smc5 A T 19: 23,186,312 (GRCm39) Y972* probably null Het
Sntg1 T C 1: 8,515,248 (GRCm39) probably null Het
Spata31h1 T C 10: 82,129,470 (GRCm39) N1180S probably benign Het
Stag1 A G 9: 100,639,786 (GRCm39) D114G probably damaging Het
Suclg1 T C 6: 73,233,192 (GRCm39) S46P probably damaging Het
Synj1 C T 16: 90,743,703 (GRCm39) A1186T probably benign Het
Tas2r124 A G 6: 132,732,410 (GRCm39) T240A probably benign Het
Tax1bp1 T C 6: 52,721,341 (GRCm39) probably null Het
Tchh C A 3: 93,355,158 (GRCm39) Q1533K unknown Het
Tmprss15 T C 16: 78,759,058 (GRCm39) T887A probably benign Het
Ttn T C 2: 76,536,937 (GRCm39) I34963V probably benign Het
Unc79 G A 12: 103,078,878 (GRCm39) G1485D probably damaging Het
Usp9y G T Y: 1,385,355 (GRCm39) H633N probably benign Homo
Vmn2r99 A T 17: 19,602,867 (GRCm39) N541Y probably damaging Het
Zbtb11 T A 16: 55,810,854 (GRCm39) N337K probably benign Het
Zfp260 T A 7: 29,804,267 (GRCm39) C56S possibly damaging Het
Zfp457 C T 13: 67,440,746 (GRCm39) E610K probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34,881,641 (GRCm39) missense probably benign 0.00
IGL00922:Hc APN 2 34,881,680 (GRCm39) missense probably damaging 1.00
IGL01523:Hc APN 2 34,929,250 (GRCm39) missense probably benign 0.04
IGL01746:Hc APN 2 34,947,338 (GRCm39) missense probably damaging 0.98
IGL01793:Hc APN 2 34,918,202 (GRCm39) missense probably damaging 1.00
IGL01972:Hc APN 2 34,873,784 (GRCm39) missense probably damaging 1.00
IGL02037:Hc APN 2 34,903,531 (GRCm39) missense probably benign 0.16
IGL02048:Hc APN 2 34,886,039 (GRCm39) missense probably benign 0.00
IGL02227:Hc APN 2 34,899,923 (GRCm39) intron probably benign
IGL02230:Hc APN 2 34,903,682 (GRCm39) missense probably benign
IGL02254:Hc APN 2 34,874,836 (GRCm39) missense probably damaging 1.00
IGL02363:Hc APN 2 34,890,847 (GRCm39) missense probably benign
IGL02650:Hc APN 2 34,890,886 (GRCm39) missense possibly damaging 0.49
IGL03053:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03168:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03341:Hc APN 2 34,893,389 (GRCm39) missense probably damaging 0.98
PIT4142001:Hc UTSW 2 34,921,833 (GRCm39) splice site probably benign
PIT4378001:Hc UTSW 2 34,921,876 (GRCm39) missense probably benign 0.13
PIT4508001:Hc UTSW 2 34,874,816 (GRCm39) missense probably damaging 0.96
PIT4812001:Hc UTSW 2 34,919,464 (GRCm39) missense probably benign 0.16
R0025:Hc UTSW 2 34,876,304 (GRCm39) missense probably damaging 1.00
R0053:Hc UTSW 2 34,947,287 (GRCm39) missense probably benign 0.32
R0197:Hc UTSW 2 34,874,762 (GRCm39) missense probably damaging 1.00
R0218:Hc UTSW 2 34,918,086 (GRCm39) missense probably damaging 1.00
R0242:Hc UTSW 2 34,926,166 (GRCm39) splice site probably benign
R0496:Hc UTSW 2 34,903,583 (GRCm39) missense probably damaging 1.00
R1205:Hc UTSW 2 34,893,536 (GRCm39) missense possibly damaging 0.50
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1574:Hc UTSW 2 34,890,777 (GRCm39) intron probably benign
R1610:Hc UTSW 2 34,896,173 (GRCm39) missense probably benign 0.44
R1640:Hc UTSW 2 34,947,336 (GRCm39) nonsense probably null
R1887:Hc UTSW 2 34,924,623 (GRCm39) missense probably benign
R1920:Hc UTSW 2 34,919,407 (GRCm39) splice site probably benign
R2018:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2019:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2151:Hc UTSW 2 34,881,115 (GRCm39) intron probably benign
R2366:Hc UTSW 2 34,903,648 (GRCm39) missense probably benign
R4093:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R4288:Hc UTSW 2 34,920,414 (GRCm39) missense probably damaging 0.98
R4501:Hc UTSW 2 34,887,488 (GRCm39) splice site probably null
R4502:Hc UTSW 2 34,896,264 (GRCm39) missense probably benign 0.00
R4508:Hc UTSW 2 34,903,077 (GRCm39) missense possibly damaging 0.94
R4583:Hc UTSW 2 34,918,189 (GRCm39) missense probably benign 0.00
R4686:Hc UTSW 2 34,929,260 (GRCm39) missense possibly damaging 0.49
R4776:Hc UTSW 2 34,929,746 (GRCm39) missense probably benign 0.12
R4846:Hc UTSW 2 34,909,682 (GRCm39) missense probably benign 0.00
R5032:Hc UTSW 2 34,903,544 (GRCm39) missense probably benign 0.07
R5089:Hc UTSW 2 34,914,902 (GRCm39) missense probably benign 0.01
R5289:Hc UTSW 2 34,886,026 (GRCm39) critical splice donor site probably null
R5347:Hc UTSW 2 34,927,636 (GRCm39) missense probably benign 0.04
R5356:Hc UTSW 2 34,885,007 (GRCm39) missense probably benign 0.00
R5379:Hc UTSW 2 34,881,077 (GRCm39) missense probably damaging 1.00
R5403:Hc UTSW 2 34,947,446 (GRCm39) missense probably damaging 1.00
R5418:Hc UTSW 2 34,898,195 (GRCm39) critical splice donor site probably null
R5450:Hc UTSW 2 34,903,050 (GRCm39) missense possibly damaging 0.67
R5494:Hc UTSW 2 34,893,551 (GRCm39) splice site probably null
R5713:Hc UTSW 2 34,903,543 (GRCm39) missense probably damaging 0.99
R5898:Hc UTSW 2 34,887,449 (GRCm39) missense probably benign 0.06
R5925:Hc UTSW 2 34,920,462 (GRCm39) missense possibly damaging 0.92
R5942:Hc UTSW 2 34,918,137 (GRCm39) nonsense probably null
R5991:Hc UTSW 2 34,896,117 (GRCm39) missense possibly damaging 0.91
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6115:Hc UTSW 2 34,903,050 (GRCm39) missense probably damaging 1.00
R6234:Hc UTSW 2 34,918,058 (GRCm39) missense probably benign
R6264:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
R6525:Hc UTSW 2 34,881,236 (GRCm39) missense probably benign 0.06
R6577:Hc UTSW 2 34,922,138 (GRCm39) missense probably benign 0.00
R6601:Hc UTSW 2 34,935,906 (GRCm39) missense probably benign 0.03
R6916:Hc UTSW 2 34,900,044 (GRCm39) nonsense probably null
R7108:Hc UTSW 2 34,929,706 (GRCm39) missense probably benign 0.03
R7143:Hc UTSW 2 34,940,450 (GRCm39) missense probably benign 0.00
R7388:Hc UTSW 2 34,874,859 (GRCm39) splice site probably null
R7468:Hc UTSW 2 34,918,063 (GRCm39) missense probably benign 0.00
R7504:Hc UTSW 2 34,951,331 (GRCm39) missense not run
R7521:Hc UTSW 2 34,935,344 (GRCm39) missense possibly damaging 0.80
R7582:Hc UTSW 2 34,881,278 (GRCm39) missense possibly damaging 0.70
R7596:Hc UTSW 2 34,890,859 (GRCm39) missense probably damaging 0.96
R7599:Hc UTSW 2 34,940,431 (GRCm39) missense probably damaging 1.00
R7692:Hc UTSW 2 34,914,161 (GRCm39) missense probably damaging 1.00
R7853:Hc UTSW 2 34,900,045 (GRCm39) missense probably damaging 1.00
R7877:Hc UTSW 2 34,887,411 (GRCm39) nonsense probably null
R8329:Hc UTSW 2 34,902,910 (GRCm39) splice site probably null
R8375:Hc UTSW 2 34,873,731 (GRCm39) missense probably benign 0.32
R8477:Hc UTSW 2 34,879,182 (GRCm39) missense probably damaging 1.00
R8810:Hc UTSW 2 34,909,535 (GRCm39) missense probably benign 0.06
R8888:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8895:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8968:Hc UTSW 2 34,922,317 (GRCm39) missense possibly damaging 0.91
R8969:Hc UTSW 2 34,909,475 (GRCm39) critical splice donor site probably null
R9146:Hc UTSW 2 34,924,571 (GRCm39) missense probably damaging 1.00
R9218:Hc UTSW 2 34,922,203 (GRCm39) missense probably damaging 1.00
R9340:Hc UTSW 2 34,876,294 (GRCm39) missense probably damaging 0.99
R9396:Hc UTSW 2 34,927,615 (GRCm39) nonsense probably null
R9569:Hc UTSW 2 34,926,359 (GRCm39) missense probably benign 0.00
R9576:Hc UTSW 2 34,873,767 (GRCm39) missense probably benign 0.01
R9706:Hc UTSW 2 34,914,196 (GRCm39) missense probably damaging 1.00
X0066:Hc UTSW 2 34,873,723 (GRCm39) missense probably damaging 1.00
Z1088:Hc UTSW 2 34,919,482 (GRCm39) missense probably benign 0.02
Z1088:Hc UTSW 2 34,898,261 (GRCm39) missense possibly damaging 0.94
Z1176:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
Z1177:Hc UTSW 2 34,903,622 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGAAAGCACATTGTGTCC -3'
(R):5'- AGCCTGGCCCTTTTAAAGACC -3'

Sequencing Primer
(F):5'- AAAGCACATTGTGTCCCCTGG -3'
(R):5'- CTTGTAAGAGACTCAGTGGCC -3'
Posted On 2018-07-27