Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Notch3'

529315

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6313 (G1)

Quality Score

137.008

Status

Validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

splice site (132 bp from exon)

DNA Base Change (assembly)

A to T at 32151154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

AlphaFold

Q61982

Predicted Effect

probably null
Transcript: ENSMUST00000087723

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
impressed	UTSW	17	32166678	missense	probably benign
indented	UTSW	17	32147963	missense	probably benign	0.00
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
marginal	UTSW	17	32164224	missense	probably benign
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2112:Notch3	UTSW	17	32144610	missense	probably benign	0.19
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2211:Notch3	UTSW	17	32147978	missense	probably benign	0.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3434:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6502:Notch3	UTSW	17	32158217	missense	probably damaging	1.00
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7171:Notch3	UTSW	17	32158962	missense	probably damaging	1.00
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
R7860:Notch3	UTSW	17	32122773	missense	possibly damaging	0.67
R8052:Notch3	UTSW	17	32146571	missense	probably damaging	1.00
R8250:Notch3	UTSW	17	32132336	missense	probably damaging	1.00
R8296:Notch3	UTSW	17	32122739	missense	probably damaging	1.00
R8306:Notch3	UTSW	17	32158112	missense	probably damaging	0.99
R8458:Notch3	UTSW	17	32156050	missense	probably damaging	1.00
R8539:Notch3	UTSW	17	32156355	missense	possibly damaging	0.92
R8865:Notch3	UTSW	17	32122116	missense	probably benign	0.01
R8925:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R8927:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R9062:Notch3	UTSW	17	32122718	missense	possibly damaging	0.93
R9079:Notch3	UTSW	17	32164059	intron	probably benign
R9089:Notch3	UTSW	17	32151547	missense	probably benign	0.00
R9260:Notch3	UTSW	17	32143242	critical splice donor site	probably null
R9289:Notch3	UTSW	17	32158280	missense	probably damaging	1.00
R9294:Notch3	UTSW	17	32143691	missense	probably benign	0.03
R9661:Notch3	UTSW	17	32154818	missense	probably damaging	1.00
R9779:Notch3	UTSW	17	32153783	missense	probably damaging	1.00
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94
Z1176:Notch3	UTSW	17	32141516	missense	probably benign	0.12
Z1176:Notch3	UTSW	17	32151370	missense	probably damaging	1.00
Z1177:Notch3	UTSW	17	32166694	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGTCCCCACCCTGATATTTAG -3'
(R):5'- TGGAATAGGCTTTCGCTGC -3'

Sequencing Primer
(F):5'- TGGTTCAGCAGTTAAGAGCACCTC -3'
(R):5'- GAATAGGCTTTCGCTGCACCTG -3'

Posted On

2018-07-27