Incidental Mutation 'R6323:Madd'
ID529321
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene NameMAP-kinase activating death domain
SynonymsRab3 GEP, 9630059K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91137360-91183837 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 91161438 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381]
Predicted Effect probably null
Transcript: ENSMUST00000066420
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111369
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111370
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111375
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125321
Predicted Effect probably benign
Transcript: ENSMUST00000111376
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130395
Predicted Effect probably benign
Transcript: ENSMUST00000111381
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153688
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91175766 unclassified probably benign
IGL00781:Madd APN 2 91146928 missense probably benign 0.00
IGL00844:Madd APN 2 91167868 missense probably damaging 1.00
IGL00942:Madd APN 2 91170578 missense probably damaging 1.00
IGL01100:Madd APN 2 91158040 missense probably damaging 1.00
IGL01116:Madd APN 2 91154543 splice site probably benign
IGL01694:Madd APN 2 91157975 splice site probably benign
IGL01982:Madd APN 2 91175707 missense probably damaging 1.00
IGL02346:Madd APN 2 91162491 missense probably damaging 0.97
IGL02354:Madd APN 2 91162198 missense probably benign 0.17
IGL02361:Madd APN 2 91162198 missense probably benign 0.17
IGL02481:Madd APN 2 91178036 missense probably damaging 1.00
IGL02483:Madd APN 2 91178036 missense probably damaging 1.00
IGL02948:Madd APN 2 91142827 missense probably benign
IGL03338:Madd APN 2 91162162 missense possibly damaging 0.48
BB005:Madd UTSW 2 91176888 missense probably damaging 1.00
BB015:Madd UTSW 2 91176888 missense probably damaging 1.00
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0027:Madd UTSW 2 91152549 missense probably damaging 0.97
R0085:Madd UTSW 2 91162738 missense probably benign 0.00
R0577:Madd UTSW 2 91138395 missense possibly damaging 0.88
R0587:Madd UTSW 2 91146885 missense probably damaging 1.00
R1112:Madd UTSW 2 91143599 missense probably damaging 1.00
R1722:Madd UTSW 2 91167637 missense probably benign
R1750:Madd UTSW 2 91167891 missense probably damaging 0.98
R2061:Madd UTSW 2 91161486 intron probably benign
R2112:Madd UTSW 2 91176976 missense possibly damaging 0.89
R2114:Madd UTSW 2 91164022 missense probably damaging 1.00
R2140:Madd UTSW 2 91152509 missense possibly damaging 0.80
R2276:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2277:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2279:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2424:Madd UTSW 2 91166622 missense probably damaging 1.00
R2904:Madd UTSW 2 91175672 missense probably damaging 1.00
R3122:Madd UTSW 2 91176209 missense probably damaging 1.00
R3836:Madd UTSW 2 91154643 critical splice donor site probably null
R3979:Madd UTSW 2 91176828 missense possibly damaging 0.81
R4151:Madd UTSW 2 91143083 missense probably benign 0.11
R4233:Madd UTSW 2 91178236 missense probably benign 0.26
R4236:Madd UTSW 2 91167028 missense probably benign 0.00
R4299:Madd UTSW 2 91169803 missense probably damaging 1.00
R4334:Madd UTSW 2 91140572 missense probably benign 0.08
R4413:Madd UTSW 2 91167587 missense probably damaging 1.00
R4595:Madd UTSW 2 91167664 missense possibly damaging 0.80
R4694:Madd UTSW 2 91160328 missense probably damaging 0.99
R5410:Madd UTSW 2 91154514 missense probably damaging 1.00
R5490:Madd UTSW 2 91170635 missense possibly damaging 0.80
R5560:Madd UTSW 2 91163545 missense probably damaging 1.00
R5661:Madd UTSW 2 91154433 critical splice donor site probably null
R5710:Madd UTSW 2 91154476 missense probably damaging 1.00
R5730:Madd UTSW 2 91158109 missense probably damaging 1.00
R5759:Madd UTSW 2 91162075 missense possibly damaging 0.94
R5768:Madd UTSW 2 91167829 missense probably damaging 1.00
R5822:Madd UTSW 2 91152533 missense probably damaging 1.00
R6125:Madd UTSW 2 91152452 critical splice donor site probably null
R6151:Madd UTSW 2 91165457 nonsense probably null
R6229:Madd UTSW 2 91143670 missense probably damaging 0.96
R6230:Madd UTSW 2 91143521 critical splice donor site probably null
R6245:Madd UTSW 2 91178104 missense probably benign 0.27
R6456:Madd UTSW 2 91178191 missense probably benign
R6473:Madd UTSW 2 91167059 missense probably benign
R6878:Madd UTSW 2 91169857 missense probably damaging 1.00
R7060:Madd UTSW 2 91177107 missense probably damaging 1.00
R7065:Madd UTSW 2 91155057 missense probably benign 0.26
R7073:Madd UTSW 2 91162509 missense probably damaging 1.00
R7124:Madd UTSW 2 91162048 missense possibly damaging 0.94
R7251:Madd UTSW 2 91162176 missense probably benign 0.01
R7510:Madd UTSW 2 91177976 missense possibly damaging 0.80
R7605:Madd UTSW 2 91169710 missense possibly damaging 0.90
R7911:Madd UTSW 2 91167508 missense probably null 0.01
R7928:Madd UTSW 2 91176888 missense probably damaging 1.00
R7952:Madd UTSW 2 91162541 missense probably damaging 1.00
R8039:Madd UTSW 2 91167061 missense probably benign 0.17
R8047:Madd UTSW 2 91179201 missense probably damaging 1.00
R8048:Madd UTSW 2 91154448 missense probably damaging 0.99
R8070:Madd UTSW 2 91158014 nonsense probably null
R8090:Madd UTSW 2 91155623 missense probably benign 0.01
R8335:Madd UTSW 2 91170239 missense probably damaging 1.00
R8459:Madd UTSW 2 91162526 missense probably benign
R8678:Madd UTSW 2 91176265 missense probably damaging 1.00
R8920:Madd UTSW 2 91176823 missense probably benign 0.04
X0067:Madd UTSW 2 91152473 missense probably damaging 1.00
Z1176:Madd UTSW 2 91159272 missense probably damaging 0.96
Z1177:Madd UTSW 2 91142831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGAAGAGAGCTGCTTC -3'
(R):5'- ATGATCATCTGGGTCTCTGCATC -3'

Sequencing Primer
(F):5'- AGAAGAGAGCTGCTTCATTCCTCTG -3'
(R):5'- AAGCATTACAACACTGCTCTGGG -3'
Posted On2018-07-27