Incidental Mutation 'R6284:Oprl1'
ID529323
Institutional Source Beutler Lab
Gene Symbol Oprl1
Ensembl Gene ENSMUSG00000027584
Gene Nameopioid receptor-like 1
SynonymsORL1, morc, N/OFQ receptor, MOR-C, nociceptin/ orphaninFQ receptor, LC132, XOR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181715016-181720985 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 181717991 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071585] [ENSMUST00000108763] [ENSMUST00000108766] [ENSMUST00000108767] [ENSMUST00000108768] [ENSMUST00000148334] [ENSMUST00000183693] [ENSMUST00000184127] [ENSMUST00000184795]
Predicted Effect probably benign
Transcript: ENSMUST00000071585
SMART Domains Protein: ENSMUSP00000071513
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7tm_4 54 334 5.8e-9 PFAM
Pfam:7TM_GPCR_Srx 56 264 1.4e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 1.4e-62 PFAM
Pfam:7TM_GPCR_Srv 112 332 7.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108763
SMART Domains Protein: ENSMUSP00000104394
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 317 6.9e-11 PFAM
Pfam:7tm_1 60 302 1.6e-62 PFAM
Pfam:7TM_GPCR_Srv 91 318 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108766
SMART Domains Protein: ENSMUSP00000104397
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 189 3.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 59 201 1.8e-9 PFAM
Pfam:7tm_1 65 210 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108767
SMART Domains Protein: ENSMUSP00000104398
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108768
SMART Domains Protein: ENSMUSP00000104399
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126835
Predicted Effect probably benign
Transcript: ENSMUST00000148334
SMART Domains Protein: ENSMUSP00000118664
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7tm_1 65 140 5.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151241
Predicted Effect unknown
Transcript: ENSMUST00000183693
AA Change: F87L
SMART Domains Protein: ENSMUSP00000138810
Gene: ENSMUSG00000027584
AA Change: F87L

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 77 1e-3 SMART
PDB:4EA3|B 41 76 9e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184127
SMART Domains Protein: ENSMUSP00000139119
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 76 3e-4 SMART
PDB:4EA3|B 41 76 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184795
SMART Domains Protein: ENSMUSP00000138979
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 71 2e-3 SMART
PDB:4EA3|B 41 71 5e-13 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit altered touch/nociception, facilitation of long-term potentiation and memory, increased dopamine release upon administration of opioid peptide agonist, impaired behavioral response to morphine, and increased susceptibility to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Nop14 C T 5: 34,641,491 probably null Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Oprl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Oprl1 APN 2 181718511 missense probably damaging 1.00
R0302:Oprl1 UTSW 2 181719228 missense probably benign 0.01
R0453:Oprl1 UTSW 2 181718734 critical splice donor site probably null
R1564:Oprl1 UTSW 2 181718940 missense possibly damaging 0.79
R1618:Oprl1 UTSW 2 181718853 missense probably benign 0.22
R4801:Oprl1 UTSW 2 181719253 missense probably benign
R4802:Oprl1 UTSW 2 181719253 missense probably benign
R5032:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R5133:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R5134:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R6374:Oprl1 UTSW 2 181715928 missense probably damaging 1.00
R6394:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R6843:Oprl1 UTSW 2 181715754 missense probably damaging 1.00
R7009:Oprl1 UTSW 2 181718381 missense probably damaging 1.00
X0022:Oprl1 UTSW 2 181715807 missense probably benign 0.28
X0024:Oprl1 UTSW 2 181718548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGATGAGAAAGTTGGTTTTC -3'
(R):5'- TACACCCAAGGTCCACTGAG -3'

Sequencing Primer
(F):5'- ctggaaatggaactcaggt -3'
(R):5'- GGTCCACTGAGCCTAGGACTTTAAC -3'
Posted On2018-07-27