Incidental Mutation 'R6284:Nop14'
ID529324
Institutional Source Beutler Lab
Gene Symbol Nop14
Ensembl Gene ENSMUSG00000036693
Gene NameNOP14 nucleolar protein
SynonymsNol14, 2610033H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6284 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34638536-34660148 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 34641491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001109] [ENSMUST00000041364] [ENSMUST00000041364] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000124668] [ENSMUST00000126257] [ENSMUST00000137150] [ENSMUST00000149657] [ENSMUST00000155577]
Predicted Effect probably null
Transcript: ENSMUST00000001109
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041364
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041364
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114329
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114331
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124668
SMART Domains Protein: ENSMUSP00000119140
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138212
Predicted Effect probably null
Transcript: ENSMUST00000149657
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152393
Predicted Effect probably null
Transcript: ENSMUST00000155577
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201897
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik G T 6: 72,347,454 G16C probably damaging Het
Abca7 G A 10: 80,004,410 V801I probably benign Het
Adgrl2 A T 3: 148,826,507 L1030Q probably damaging Het
Akap1 T C 11: 88,844,568 T423A possibly damaging Het
Anpep T A 7: 79,825,802 D111V probably damaging Het
Atm T A 9: 53,445,376 probably null Het
Atp5a1 T A 18: 77,778,468 S106T probably benign Het
Atp5k T C 5: 108,434,059 I20V probably benign Het
Atp6v0d2 T A 4: 19,922,605 probably null Het
Bclaf1 T G 10: 20,322,160 probably null Het
Bod1l A G 5: 41,818,787 V1728A probably benign Het
Braf A G 6: 39,688,282 F51L possibly damaging Het
Camsap2 A G 1: 136,304,437 I140T possibly damaging Het
Ccdc24 A T 4: 117,869,653 probably null Het
Cdh26 G C 2: 178,449,884 G79R probably damaging Het
Cenpf A G 1: 189,652,742 L2447P probably damaging Het
Cfap74 T C 4: 155,451,796 F863L probably damaging Het
Clstn2 C T 9: 97,454,674 G917S probably benign Het
Col6a6 A T 9: 105,727,227 probably null Het
Cul5 G A 9: 53,623,735 P596L probably damaging Het
Dst A T 1: 34,229,085 R2863W probably damaging Het
Dthd1 A G 5: 62,814,041 E69G possibly damaging Het
Erich2 T A 2: 70,539,684 I402N probably damaging Het
Fam160a1 G A 3: 85,672,688 P737S probably benign Het
Fam162b T C 10: 51,585,502 K155R probably damaging Het
Glb1l2 A T 9: 26,767,448 S466T probably benign Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gm5724 T C 6: 141,725,393 D451G probably damaging Het
Ikbkap A T 4: 56,762,281 I1106K probably damaging Het
Kazn G A 4: 142,117,197 L402F probably benign Het
Kcnj13 A T 1: 87,386,886 S205T probably damaging Het
Lama1 T A 17: 67,810,096 V2462E probably damaging Het
Lce1b A C 3: 92,656,104 C41G unknown Het
Lyar T A 5: 38,225,995 W77R probably damaging Het
March11 G A 15: 26,409,346 R377Q probably benign Het
Mis18bp1 A G 12: 65,138,787 F869L probably benign Het
Myom1 T A 17: 71,022,892 Y6* probably null Het
Myzap T C 9: 71,558,925 I150V probably benign Het
Oprl1 T A 2: 181,717,991 probably benign Het
Pacsin1 T C 17: 27,708,504 L432P probably damaging Het
Peak1 A G 9: 56,260,296 L116P probably benign Het
Plcb2 C T 2: 118,717,301 V482M probably benign Het
Pnliprp1 T A 19: 58,734,984 I269N probably damaging Het
Pnpla7 C A 2: 25,016,618 D664E possibly damaging Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Rps6kb2 G T 19: 4,161,187 T113K probably benign Het
Rrp7a A T 15: 83,121,860 I63N probably damaging Het
Slc29a1 A G 17: 45,589,921 probably null Het
Stxbp5 A C 10: 9,767,179 S1059A probably benign Het
Stxbp5 C A 10: 9,767,187 G1056V probably damaging Het
Taldo1 T A 7: 141,398,583 S149T possibly damaging Het
Tlr1 T C 5: 64,927,099 D45G possibly damaging Het
Tnrc6a T C 7: 123,171,335 S783P probably damaging Het
Trap1 A G 16: 4,060,809 Y220H probably benign Het
Trpc6 A G 9: 8,643,600 D462G possibly damaging Het
Ttc21a A G 9: 119,943,962 E235G probably damaging Het
Tubb4a A G 17: 57,080,833 Y398H probably damaging Het
Ube2z A G 11: 96,050,407 F303S probably damaging Het
Vmn1r211 A G 13: 22,852,084 S138P probably damaging Het
Zfp93 T A 7: 24,275,629 C346* probably null Het
Zfp938 A T 10: 82,227,566 S52R possibly damaging Het
Zp1 A T 19: 10,916,503 L446Q probably damaging Het
Other mutations in Nop14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Nop14 APN 5 34641313 unclassified probably benign
IGL00985:Nop14 APN 5 34644789 missense probably damaging 0.98
IGL01626:Nop14 APN 5 34649345 nonsense probably null
IGL02676:Nop14 APN 5 34639221 missense probably damaging 0.97
IGL03189:Nop14 APN 5 34650628 unclassified probably benign
IGL03047:Nop14 UTSW 5 34660014 missense possibly damaging 0.93
R0025:Nop14 UTSW 5 34643953 missense probably benign 0.08
R0831:Nop14 UTSW 5 34650520 missense possibly damaging 0.70
R1027:Nop14 UTSW 5 34644004 missense probably damaging 0.99
R1252:Nop14 UTSW 5 34650555 missense probably benign
R1616:Nop14 UTSW 5 34650413 missense possibly damaging 0.46
R1845:Nop14 UTSW 5 34650328 missense possibly damaging 0.82
R2032:Nop14 UTSW 5 34659939 missense possibly damaging 0.65
R3693:Nop14 UTSW 5 34654438 missense probably damaging 0.98
R4033:Nop14 UTSW 5 34650517 missense probably benign
R4168:Nop14 UTSW 5 34656744 missense probably damaging 0.99
R4172:Nop14 UTSW 5 34650607 missense probably damaging 0.99
R4618:Nop14 UTSW 5 34639218 missense probably damaging 1.00
R4936:Nop14 UTSW 5 34652393 missense probably damaging 1.00
R6067:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6075:Nop14 UTSW 5 34659891 missense probably damaging 1.00
R6078:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R7295:Nop14 UTSW 5 34639032 missense probably damaging 0.99
R7585:Nop14 UTSW 5 34644780 missense probably damaging 1.00
R7626:Nop14 UTSW 5 34651791 missense probably damaging 0.99
R8079:Nop14 UTSW 5 34654461 missense probably damaging 1.00
U15987:Nop14 UTSW 5 34657951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGTGTGATTTGCCTCAG -3'
(R):5'- GGAGCTTTCCTCACAGGTATC -3'

Sequencing Primer
(F):5'- GATTTGCCTCAGTCGCTGTCAG -3'
(R):5'- CCTCCTGAATGCTGGCATTAAAGG -3'
Posted On2018-07-27