Incidental Mutation 'R6143:Cebpb'
ID529369
Institutional Source Beutler Lab
Gene Symbol Cebpb
Ensembl Gene ENSMUSG00000056501
Gene NameCCAAT/enhancer binding protein (C/EBP), beta
SynonymsNF-M, LIP, NF-IL6, C/EBP BETA, Nfil6, C/EBPbeta, CRP2, LAP, IL-6DBP
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R6143 (G1)
Quality Score56.0072
Status Validated
Chromosome2
Chromosomal Location167688915-167690418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 167689300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 93 (D93E)
Ref Sequence ENSEMBL: ENSMUSP00000069850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070642]
PDB Structure TRANSCRIPTION FACTOR ATF4-C/EBP BETA BZIP HETERODIMER [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000070642
AA Change: D93E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069850
Gene: ENSMUSG00000056501
AA Change: D93E

DomainStartEndE-ValueType
low complexity region 38 53 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 169 216 N/A INTRINSIC
BRLZ 220 284 1.63e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148262
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high neonatal hypoglycemia and mortality, reduced epididymal fat pad weight, susceptibility to Listeria monocytogenes, female sterility, impaired mammary development, and resistance to skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Cebpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2159:Cebpb UTSW 2 167689253 missense probably benign 0.28
R4934:Cebpb UTSW 2 167689085 missense probably benign 0.39
R7731:Cebpb UTSW 2 167689206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTACTACGAGCCCGAC -3'
(R):5'- TGTACTCGTCGCTCAGCTTG -3'

Sequencing Primer
(F):5'- TACGAGCCCGACTGCCTG -3'
(R):5'- ACGACGTGGACAGGCTG -3'
Posted On2018-07-31