Incidental Mutation 'R6199:Naip6'
ID529374
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 044339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6199 (G1)
Quality Score53.0072
Status Validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100300600 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 472 (A472T)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably benign
Transcript: ENSMUST00000042220
AA Change: A472T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: A472T

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118574
AA Change: A472T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: A472T

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.4073 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
R7485:Naip6 UTSW 13 100283851 missense probably benign 0.07
R7597:Naip6 UTSW 13 100300600 missense probably benign 0.08
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGCTCAGACACACTTC -3'
(R):5'- TGAGCAGCTGAGAGACACCTAC -3'

Sequencing Primer
(F):5'- GCTGCTCAGACACACTTCACTAATG -3'
(R):5'- CACTAAAACCAGTTTCTGCCACATG -3'
Posted On2018-07-31