Incidental Mutation 'R6314:Fcrl6'
ID529387
Institutional Source Beutler Lab
Gene Symbol Fcrl6
Ensembl Gene ENSMUSG00000070504
Gene NameFc receptor-like 6
SynonymsENSMUSG00000070504, mIFGP6, moFcRH6, FcRH6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172596642-172602551 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 172598619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094303]
Predicted Effect probably null
Transcript: ENSMUST00000094303
SMART Domains Protein: ENSMUSP00000091861
Gene: ENSMUSG00000070504

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ig_3 19 91 1.2e-4 PFAM
Pfam:Ig_2 20 106 8e-9 PFAM
Pfam:Ig_3 113 187 1.9e-9 PFAM
transmembrane domain 215 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193566
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Fcrl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Fcrl6 APN 1 172599107 missense probably benign 0.08
IGL01074:Fcrl6 APN 1 172599113 missense possibly damaging 0.89
IGL02146:Fcrl6 APN 1 172598697 missense probably benign 0.01
IGL02277:Fcrl6 APN 1 172599119 missense probably damaging 1.00
IGL03162:Fcrl6 APN 1 172598253 missense probably damaging 1.00
IGL03303:Fcrl6 APN 1 172597688 missense probably damaging 0.99
K3955:Fcrl6 UTSW 1 172597684 missense probably benign 0.00
R0051:Fcrl6 UTSW 1 172598753 missense probably benign 0.24
R0051:Fcrl6 UTSW 1 172598753 missense probably benign 0.24
R1336:Fcrl6 UTSW 1 172599224 nonsense probably null
R2125:Fcrl6 UTSW 1 172599248 missense probably benign 0.41
R2126:Fcrl6 UTSW 1 172599248 missense probably benign 0.41
R5376:Fcrl6 UTSW 1 172599280 missense probably damaging 1.00
R5395:Fcrl6 UTSW 1 172598720 missense possibly damaging 0.55
R7525:Fcrl6 UTSW 1 172597672 missense probably benign 0.25
R7690:Fcrl6 UTSW 1 172598656 missense probably damaging 0.97
R8033:Fcrl6 UTSW 1 172599181 missense probably benign 0.03
U24488:Fcrl6 UTSW 1 172598870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGCTAGCATGAGCAATC -3'
(R):5'- GACAAGGTGGAGTTCCTCTG -3'

Sequencing Primer
(F):5'- CTAGCATGAGCAATCATGTTATGGG -3'
(R):5'- TCTGTGAGGCCCACCAG -3'
Posted On2018-08-01