Incidental Mutation 'R6314:Sec24b'
ID529388
Institutional Source Beutler Lab
Gene Symbol Sec24b
Ensembl Gene ENSMUSG00000001052
Gene NameSec24 related gene family, member B (S. cerevisiae)
SynonymsSEC24
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R6314 (G1)
Quality Score92.0077
Status Validated
Chromosome3
Chromosomal Location129982759-130061553 bp(-) (GRCm38)
Type of Mutationunclassified (166 bp from exon)
DNA Base Change (assembly) A to T at 130007245 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873] [ENSMUST00000168644]
Predicted Effect probably null
Transcript: ENSMUST00000001079
SMART Domains Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 229 254 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
low complexity region 450 473 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 585 622 4.1e-17 PFAM
Pfam:Sec23_trunk 658 897 2.4e-87 PFAM
Pfam:Sec23_BS 902 986 3.4e-23 PFAM
Pfam:Sec23_helical 999 1099 8.7e-31 PFAM
Pfam:Gelsolin 1122 1197 4.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165873
SMART Domains Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 123 N/A INTRINSIC
low complexity region 156 181 N/A INTRINSIC
low complexity region 187 210 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 321 359 2.5e-18 PFAM
Pfam:Sec23_trunk 395 634 1.6e-87 PFAM
Pfam:Sec23_BS 639 723 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165889
Predicted Effect probably null
Transcript: ENSMUST00000168644
SMART Domains Protein: ENSMUSP00000126923
Gene: ENSMUSG00000001052

DomainStartEndE-ValueType
low complexity region 93 118 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 249 257 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 321 344 N/A INTRINSIC
low complexity region 357 376 N/A INTRINSIC
PDB:3EH1|A 377 411 1e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168908
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Sec24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Sec24b APN 3 130020646 intron probably benign
IGL01137:Sec24b APN 3 130007444 missense probably benign 0.02
IGL01370:Sec24b APN 3 130007604 splice site probably benign
IGL01931:Sec24b APN 3 130009799 missense probably benign 0.00
PIT4696001:Sec24b UTSW 3 129994391 missense probably benign 0.01
R0193:Sec24b UTSW 3 129988984 missense probably null
R0194:Sec24b UTSW 3 129984165 critical splice donor site probably null
R0403:Sec24b UTSW 3 129989676 missense possibly damaging 0.81
R0403:Sec24b UTSW 3 129999534 missense probably damaging 1.00
R0576:Sec24b UTSW 3 130041336 missense probably benign 0.11
R0583:Sec24b UTSW 3 130041311 nonsense probably null
R0963:Sec24b UTSW 3 130040905 missense probably benign 0.02
R0967:Sec24b UTSW 3 129996782 missense probably damaging 1.00
R1344:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1418:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1594:Sec24b UTSW 3 129991351 missense probably benign 0.00
R1716:Sec24b UTSW 3 130041016 missense possibly damaging 0.89
R1938:Sec24b UTSW 3 129991361 missense possibly damaging 0.82
R2020:Sec24b UTSW 3 129987728 missense probably damaging 1.00
R2407:Sec24b UTSW 3 130002316 missense probably benign 0.02
R2415:Sec24b UTSW 3 129996080 missense probably benign 0.00
R3121:Sec24b UTSW 3 130002304 critical splice donor site probably null
R3729:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3731:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3789:Sec24b UTSW 3 130020627 missense probably benign 0.00
R4229:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4230:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4617:Sec24b UTSW 3 130040764 missense possibly damaging 0.94
R4856:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4886:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4913:Sec24b UTSW 3 130002379 missense probably benign 0.07
R5510:Sec24b UTSW 3 130040895 missense probably damaging 1.00
R5601:Sec24b UTSW 3 130040834 small insertion probably benign
R6167:Sec24b UTSW 3 129988901 missense possibly damaging 0.88
R6442:Sec24b UTSW 3 129996701 missense probably damaging 1.00
R6512:Sec24b UTSW 3 130041297 missense probably damaging 1.00
R6743:Sec24b UTSW 3 130041232 missense probably damaging 0.98
R7081:Sec24b UTSW 3 129987742 missense probably benign 0.00
R7179:Sec24b UTSW 3 129988946 missense probably damaging 1.00
R7214:Sec24b UTSW 3 130033860 missense probably benign 0.19
R7332:Sec24b UTSW 3 130041393 missense probably benign 0.10
R7414:Sec24b UTSW 3 130009865 missense probably benign 0.01
R7599:Sec24b UTSW 3 130040811 small insertion probably benign
R7774:Sec24b UTSW 3 129984197 missense possibly damaging 0.88
R7895:Sec24b UTSW 3 129995949 missense probably benign 0.13
R7978:Sec24b UTSW 3 129995949 missense probably benign 0.13
X0065:Sec24b UTSW 3 129996355 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTCACTTTCAAGAAGGGCC -3'
(R):5'- AGTTAAACTGTAGTCCAGAGTAGGTAC -3'

Sequencing Primer
(F):5'- GTCCTCAGTCGCCATGTAAAAGAG -3'
(R):5'- GTAGGTACTCTTTACTTTACAGCATC -3'
Posted On2018-08-01