Incidental Mutation 'R6716:Bmp7'
ID529393
Institutional Source Beutler Lab
Gene Symbol Bmp7
Ensembl Gene ENSMUSG00000008999
Gene Namebone morphogenetic protein 7
Synonymsosteogenic protein 1, OP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6716 (G1)
Quality Score175.009
Status Not validated
Chromosome2
Chromosomal Location172868012-172940321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172872889 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 376 (A376T)
Ref Sequence ENSEMBL: ENSMUSP00000009143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009143]
Predicted Effect probably damaging
Transcript: ENSMUST00000009143
AA Change: A376T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009143
Gene: ENSMUSG00000008999
AA Change: A376T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TGFb_propeptide 34 279 4.3e-97 PFAM
TGFB 329 430 2.14e-68 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. Mutation of this gene results in skeletal, kidney, and other developmental defects. [provided by RefSeq, Jul 2016]
PHENOTYPE: Various homozygous targeted mutations result in postnatal lethality, a wide range of skeletal and cartilage abnormalities, renal dysplasia and polycystic kidney, and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,573,616 I312L probably benign Het
Bnip2 T C 9: 70,003,661 I296T probably damaging Het
Chrm2 T A 6: 36,524,435 I409N probably damaging Het
Fat3 T A 9: 15,919,269 T4310S probably benign Het
Kdm2a A G 19: 4,329,102 S122P probably damaging Het
Krt20 T C 11: 99,431,928 T294A possibly damaging Het
Macf1 C T 4: 123,508,438 S635N probably damaging Het
Nphs2 A G 1: 156,321,067 S242G probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rab11fip3 G T 17: 25,991,057 S1028R probably damaging Het
Sec23a C T 12: 58,968,823 G711D probably benign Het
Slc50a1 T C 3: 89,269,907 T68A probably damaging Het
Sphkap C T 1: 83,362,228 probably null Het
Tas2r122 A T 6: 132,711,897 I11N probably damaging Het
Tpr C T 1: 150,414,765 R782C probably damaging Het
Vps13c T C 9: 67,951,467 L2733P probably benign Het
Vtn C T 11: 78,500,226 R211C probably damaging Het
Xrcc1 T C 7: 24,567,146 probably null Het
Zc2hc1b T C 10: 13,171,283 D28G probably damaging Het
Other mutations in Bmp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Bmp7 APN 2 172875262 missense probably damaging 1.00
IGL01143:Bmp7 APN 2 172879482 missense probably benign
IGL01636:Bmp7 APN 2 172875208 splice site probably benign
IGL02331:Bmp7 APN 2 172872931 missense probably damaging 1.00
IGL03211:Bmp7 APN 2 172872883 missense possibly damaging 0.70
R1957:Bmp7 UTSW 2 172939921 missense probably damaging 0.97
R2044:Bmp7 UTSW 2 172939915 missense possibly damaging 0.46
R3772:Bmp7 UTSW 2 172870222 missense probably damaging 1.00
R4392:Bmp7 UTSW 2 172916542 missense probably benign 0.25
R6774:Bmp7 UTSW 2 172872958 missense probably damaging 1.00
R6864:Bmp7 UTSW 2 172940062 missense probably benign 0.00
R6904:Bmp7 UTSW 2 172872913 missense probably damaging 0.97
R7295:Bmp7 UTSW 2 172939897 missense probably damaging 1.00
R7390:Bmp7 UTSW 2 172870205 missense probably damaging 1.00
R7392:Bmp7 UTSW 2 172870205 missense probably damaging 1.00
R7560:Bmp7 UTSW 2 172939964 missense possibly damaging 0.85
R7871:Bmp7 UTSW 2 172939991 missense probably benign 0.00
R7954:Bmp7 UTSW 2 172939991 missense probably benign 0.00
X0024:Bmp7 UTSW 2 172939801 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGGTTCTGGGTCAACAGCAG -3'
(R):5'- TATGTCCACTGGGCATGAGGAG -3'

Sequencing Primer
(F):5'- GCAGGAGAAGCCACTCATAC -3'
(R):5'- TGGGACACACAGAGGTACCAC -3'
Posted On2018-08-01