Incidental Mutation 'R6716:Sec23a'
ID529407
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R6716 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58968823 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 711 (G711D)
Ref Sequence ENSEMBL: ENSMUSP00000021375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably benign
Transcript: ENSMUST00000021375
AA Change: G711D

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: G711D

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154399
Predicted Effect probably benign
Transcript: ENSMUST00000165134
AA Change: G682D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: G682D

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,573,616 I312L probably benign Het
Bmp7 C T 2: 172,872,889 A376T probably damaging Het
Bnip2 T C 9: 70,003,661 I296T probably damaging Het
Chrm2 T A 6: 36,524,435 I409N probably damaging Het
Fat3 T A 9: 15,919,269 T4310S probably benign Het
Kdm2a A G 19: 4,329,102 S122P probably damaging Het
Krt20 T C 11: 99,431,928 T294A possibly damaging Het
Macf1 C T 4: 123,508,438 S635N probably damaging Het
Nphs2 A G 1: 156,321,067 S242G probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rab11fip3 G T 17: 25,991,057 S1028R probably damaging Het
Slc50a1 T C 3: 89,269,907 T68A probably damaging Het
Sphkap C T 1: 83,362,228 probably null Het
Tas2r122 A T 6: 132,711,897 I11N probably damaging Het
Tpr C T 1: 150,414,765 R782C probably damaging Het
Vps13c T C 9: 67,951,467 L2733P probably benign Het
Vtn C T 11: 78,500,226 R211C probably damaging Het
Xrcc1 T C 7: 24,567,146 probably null Het
Zc2hc1b T C 10: 13,171,283 D28G probably damaging Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
R8557:Sec23a UTSW 12 59005270 missense probably damaging 0.96
R8839:Sec23a UTSW 12 58990995 missense possibly damaging 0.79
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTGGGCAACTAGGCAATAAC -3'
(R):5'- GAACTATCCAGTGCTTTTACAAGG -3'

Sequencing Primer
(F):5'- TGGGCAACTAGGCAATAACTGTATTG -3'
(R):5'- CCTTTAATCCTAGCACTTGGAAGCAG -3'
Posted On2018-08-01