Incidental Mutation 'R6717:Olfr1020'
ID529418
Institutional Source Beutler Lab
Gene Symbol Olfr1020
Ensembl Gene ENSMUSG00000046975
Gene Nameolfactory receptor 1020
SynonymsMOR201-2, GA_x6K02T2Q125-47327964-47328917
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85847030-85851794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85850223 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 257 (I257N)
Ref Sequence ENSEMBL: ENSMUSP00000150285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055840] [ENSMUST00000213515] [ENSMUST00000215347]
Predicted Effect probably damaging
Transcript: ENSMUST00000055840
AA Change: I257N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058242
Gene: ENSMUSG00000046975
AA Change: I257N

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 5.6e-55 PFAM
Pfam:7tm_1 48 297 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213515
Predicted Effect probably damaging
Transcript: ENSMUST00000215347
AA Change: I257N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Olfr1020
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Olfr1020 APN 2 85850088 missense probably damaging 1.00
R0419:Olfr1020 UTSW 2 85849967 nonsense probably null
R0771:Olfr1020 UTSW 2 85849994 missense possibly damaging 0.95
R2001:Olfr1020 UTSW 2 85850400 missense probably benign 0.09
R2002:Olfr1020 UTSW 2 85850400 missense probably benign 0.09
R4865:Olfr1020 UTSW 2 85849716 missense probably damaging 1.00
R4930:Olfr1020 UTSW 2 85849893 missense probably benign 0.00
R7124:Olfr1020 UTSW 2 85849910 missense probably benign 0.22
R8068:Olfr1020 UTSW 2 85849806 missense probably damaging 1.00
R8298:Olfr1020 UTSW 2 85850189 missense probably damaging 1.00
R8676:Olfr1020 UTSW 2 85849902 missense probably benign 0.03
R8928:Olfr1020 UTSW 2 85849574 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AATGGCATTGTGATCATGGC -3'
(R):5'- CAAATCAAATTCAGGTCTCGGTG -3'

Sequencing Primer
(F):5'- GTGATCATGGCCTTCTCCAG -3'
(R):5'- GGGTGAAAATATATACCCTTGCCTC -3'
Posted On2018-08-01