Incidental Mutation 'R6717:Gabbr2'
ID 529420
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Name gamma-aminobutyric acid type B receptor subunit 2
Synonyms Gababr2, Gpr51, LOC242425, GB2
MMRRC Submission 044835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6717 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 46662318-46991714 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46787574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 363 (V363A)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749]
AlphaFold Q80T41
Predicted Effect possibly damaging
Transcript: ENSMUST00000107749
AA Change: V363A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: V363A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Meta Mutation Damage Score 0.1816 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,114,086 (GRCm39) L3122F probably damaging Het
Atp6v1b1 A T 6: 83,730,632 (GRCm39) probably null Het
Ccdc178 A T 18: 22,153,946 (GRCm39) V621E probably damaging Het
Cfap126 T C 1: 170,941,671 (GRCm39) probably null Het
Cog2 T C 8: 125,252,488 (GRCm39) I64T probably damaging Het
Dhx9 A C 1: 153,349,210 (GRCm39) probably null Het
Efcab7 A G 4: 99,761,931 (GRCm39) D407G possibly damaging Het
Eif2b5 G T 16: 20,324,033 (GRCm39) G459C probably damaging Het
Eml5 T C 12: 98,793,765 (GRCm39) E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,901 (GRCm39) probably benign Het
Fry A G 5: 150,419,777 (GRCm39) T980A probably benign Het
Ggt6 T A 11: 72,328,346 (GRCm39) L244* probably null Het
Gprc6a T A 10: 51,491,233 (GRCm39) I768F probably damaging Het
Grk1 G A 8: 13,466,237 (GRCm39) M560I probably benign Het
Hapln4 G A 8: 70,537,740 (GRCm39) E145K probably damaging Het
Hoxd9 C T 2: 74,528,733 (GRCm39) P112S probably benign Het
Ly6g6f T A 17: 35,304,550 (GRCm39) M1L probably benign Het
Mast1 T C 8: 85,644,383 (GRCm39) T849A probably benign Het
Mob4 A T 1: 55,175,872 (GRCm39) M39L possibly damaging Het
Mrgpre A T 7: 143,335,260 (GRCm39) L81Q probably damaging Het
Mst1 T C 9: 107,957,774 (GRCm39) probably null Het
Muc5b A T 7: 141,411,559 (GRCm39) R1502* probably null Het
Or4b13 T A 2: 90,082,868 (GRCm39) I155L probably benign Het
Or5ap2 T A 2: 85,680,567 (GRCm39) I257N probably damaging Het
Or9e1 T C 11: 58,732,113 (GRCm39) Y58H probably damaging Het
Pdc A G 1: 150,208,769 (GRCm39) D84G probably damaging Het
Peak1 T C 9: 56,114,523 (GRCm39) N443D probably benign Het
Pkd1l3 T A 8: 110,341,401 (GRCm39) W85R unknown Het
Pramel31 G T 4: 144,089,227 (GRCm39) V182L probably benign Het
Rfc1 G A 5: 65,459,347 (GRCm39) Q190* probably null Het
Rfc1 A G 5: 65,470,304 (GRCm39) S68P probably damaging Het
Rnf145 T C 11: 44,452,317 (GRCm39) V432A probably benign Het
Ror2 A G 13: 53,273,018 (GRCm39) S204P probably damaging Het
Scn1a T C 2: 66,162,631 (GRCm39) E205G probably damaging Het
Slc2a8 A C 2: 32,866,189 (GRCm39) M277R probably damaging Het
Slc4a1 T C 11: 102,245,249 (GRCm39) Y566C probably damaging Het
Slc6a12 A G 6: 121,331,262 (GRCm39) N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stk33 T A 7: 108,926,823 (GRCm39) T279S possibly damaging Het
Taok3 A G 5: 117,379,015 (GRCm39) probably benign Het
Tlr11 A G 14: 50,599,561 (GRCm39) T516A probably benign Het
Tmem132c T A 5: 127,641,093 (GRCm39) L1088Q possibly damaging Het
Tmem132d T A 5: 127,861,485 (GRCm39) M879L probably benign Het
Tnk2 A G 16: 32,489,687 (GRCm39) E322G probably damaging Het
Ttc28 T C 5: 111,433,302 (GRCm39) V2081A probably benign Het
Ttn C T 2: 76,624,753 (GRCm39) probably null Het
Zfp105 T C 9: 122,759,373 (GRCm39) V348A possibly damaging Het
Zswim2 T C 2: 83,745,753 (GRCm39) R562G probably benign Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46,787,600 (GRCm39) missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46,875,711 (GRCm39) missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46,674,524 (GRCm39) missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46,736,501 (GRCm39) missense probably benign
IGL01884:Gabbr2 APN 4 46,875,711 (GRCm39) missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46,667,547 (GRCm39) missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46,684,300 (GRCm39) missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46,787,565 (GRCm39) missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46,681,223 (GRCm39) missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46,787,521 (GRCm39) missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46,718,838 (GRCm39) missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46,718,904 (GRCm39) missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46,677,474 (GRCm39) missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46,677,544 (GRCm39) missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46,664,833 (GRCm39) missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46,718,838 (GRCm39) missense probably damaging 1.00
R1368:Gabbr2 UTSW 4 46,674,464 (GRCm39) missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46,846,436 (GRCm39) missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46,684,319 (GRCm39) missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46,664,963 (GRCm39) splice site probably null
R1743:Gabbr2 UTSW 4 46,677,603 (GRCm39) missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46,739,823 (GRCm39) missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46,787,502 (GRCm39) missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46,734,119 (GRCm39) missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46,846,435 (GRCm39) missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46,718,797 (GRCm39) missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46,875,675 (GRCm39) missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46,991,139 (GRCm39) missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46,724,342 (GRCm39) missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46,681,208 (GRCm39) missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46,684,294 (GRCm39) missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46,734,113 (GRCm39) missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46,804,105 (GRCm39) missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46,787,641 (GRCm39) missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46,846,448 (GRCm39) missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46,736,459 (GRCm39) missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46,804,069 (GRCm39) missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46,681,189 (GRCm39) missense probably damaging 0.98
R7339:Gabbr2 UTSW 4 46,846,340 (GRCm39) missense probably benign 0.01
R7479:Gabbr2 UTSW 4 46,681,166 (GRCm39) missense probably damaging 0.98
R7695:Gabbr2 UTSW 4 46,875,687 (GRCm39) missense probably damaging 1.00
R7808:Gabbr2 UTSW 4 46,875,744 (GRCm39) missense possibly damaging 0.49
R7832:Gabbr2 UTSW 4 46,734,096 (GRCm39) missense probably benign 0.04
R7993:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R7994:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R8051:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R8084:Gabbr2 UTSW 4 46,736,349 (GRCm39) splice site probably null
R9050:Gabbr2 UTSW 4 46,798,659 (GRCm39) missense probably benign 0.03
R9187:Gabbr2 UTSW 4 46,674,533 (GRCm39) missense probably damaging 1.00
R9622:Gabbr2 UTSW 4 46,724,283 (GRCm39) critical splice donor site probably null
R9655:Gabbr2 UTSW 4 46,815,684 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACCTTGTATGACTCCCTAGGG -3'
(R):5'- TTCTTCCAGACCCTGCAAAC -3'

Sequencing Primer
(F):5'- GGGCACCGAGAAAACAGCC -3'
(R):5'- TGAGCAAGTCAGTGTCCACATCTG -3'
Posted On 2018-08-01