Incidental Mutation 'R6717:Tmem132d'
ID 529428
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Name transmembrane protein 132D
Synonyms C630028F04Rik
MMRRC Submission 044835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R6717 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 127860555-128510141 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127861485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 879 (M879L)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044441
AA Change: M879L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: M879L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,114,086 (GRCm39) L3122F probably damaging Het
Atp6v1b1 A T 6: 83,730,632 (GRCm39) probably null Het
Ccdc178 A T 18: 22,153,946 (GRCm39) V621E probably damaging Het
Cfap126 T C 1: 170,941,671 (GRCm39) probably null Het
Cog2 T C 8: 125,252,488 (GRCm39) I64T probably damaging Het
Dhx9 A C 1: 153,349,210 (GRCm39) probably null Het
Efcab7 A G 4: 99,761,931 (GRCm39) D407G possibly damaging Het
Eif2b5 G T 16: 20,324,033 (GRCm39) G459C probably damaging Het
Eml5 T C 12: 98,793,765 (GRCm39) E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,901 (GRCm39) probably benign Het
Fry A G 5: 150,419,777 (GRCm39) T980A probably benign Het
Gabbr2 A G 4: 46,787,574 (GRCm39) V363A possibly damaging Het
Ggt6 T A 11: 72,328,346 (GRCm39) L244* probably null Het
Gprc6a T A 10: 51,491,233 (GRCm39) I768F probably damaging Het
Grk1 G A 8: 13,466,237 (GRCm39) M560I probably benign Het
Hapln4 G A 8: 70,537,740 (GRCm39) E145K probably damaging Het
Hoxd9 C T 2: 74,528,733 (GRCm39) P112S probably benign Het
Ly6g6f T A 17: 35,304,550 (GRCm39) M1L probably benign Het
Mast1 T C 8: 85,644,383 (GRCm39) T849A probably benign Het
Mob4 A T 1: 55,175,872 (GRCm39) M39L possibly damaging Het
Mrgpre A T 7: 143,335,260 (GRCm39) L81Q probably damaging Het
Mst1 T C 9: 107,957,774 (GRCm39) probably null Het
Muc5b A T 7: 141,411,559 (GRCm39) R1502* probably null Het
Or4b13 T A 2: 90,082,868 (GRCm39) I155L probably benign Het
Or5ap2 T A 2: 85,680,567 (GRCm39) I257N probably damaging Het
Or9e1 T C 11: 58,732,113 (GRCm39) Y58H probably damaging Het
Pdc A G 1: 150,208,769 (GRCm39) D84G probably damaging Het
Peak1 T C 9: 56,114,523 (GRCm39) N443D probably benign Het
Pkd1l3 T A 8: 110,341,401 (GRCm39) W85R unknown Het
Pramel31 G T 4: 144,089,227 (GRCm39) V182L probably benign Het
Rfc1 G A 5: 65,459,347 (GRCm39) Q190* probably null Het
Rfc1 A G 5: 65,470,304 (GRCm39) S68P probably damaging Het
Rnf145 T C 11: 44,452,317 (GRCm39) V432A probably benign Het
Ror2 A G 13: 53,273,018 (GRCm39) S204P probably damaging Het
Scn1a T C 2: 66,162,631 (GRCm39) E205G probably damaging Het
Slc2a8 A C 2: 32,866,189 (GRCm39) M277R probably damaging Het
Slc4a1 T C 11: 102,245,249 (GRCm39) Y566C probably damaging Het
Slc6a12 A G 6: 121,331,262 (GRCm39) N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stk33 T A 7: 108,926,823 (GRCm39) T279S possibly damaging Het
Taok3 A G 5: 117,379,015 (GRCm39) probably benign Het
Tlr11 A G 14: 50,599,561 (GRCm39) T516A probably benign Het
Tmem132c T A 5: 127,641,093 (GRCm39) L1088Q possibly damaging Het
Tnk2 A G 16: 32,489,687 (GRCm39) E322G probably damaging Het
Ttc28 T C 5: 111,433,302 (GRCm39) V2081A probably benign Het
Ttn C T 2: 76,624,753 (GRCm39) probably null Het
Zfp105 T C 9: 122,759,373 (GRCm39) V348A possibly damaging Het
Zswim2 T C 2: 83,745,753 (GRCm39) R562G probably benign Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127,861,896 (GRCm39) missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127,861,702 (GRCm39) missense probably benign 0.31
IGL01482:Tmem132d APN 5 128,346,270 (GRCm39) missense probably damaging 0.96
IGL01785:Tmem132d APN 5 128,061,379 (GRCm39) missense probably benign 0.00
IGL02409:Tmem132d APN 5 127,861,952 (GRCm39) missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127,861,043 (GRCm39) missense probably benign 0.01
IGL03411:Tmem132d APN 5 128,061,347 (GRCm39) nonsense probably null
R0113:Tmem132d UTSW 5 127,861,657 (GRCm39) missense probably benign 0.11
R0420:Tmem132d UTSW 5 127,941,710 (GRCm39) missense probably benign 0.26
R0437:Tmem132d UTSW 5 127,866,849 (GRCm39) missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128,346,267 (GRCm39) missense probably damaging 1.00
R0564:Tmem132d UTSW 5 127,861,842 (GRCm39) missense probably damaging 1.00
R0659:Tmem132d UTSW 5 128,061,351 (GRCm39) missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 128,061,503 (GRCm39) splice site probably benign
R1209:Tmem132d UTSW 5 127,861,934 (GRCm39) missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127,861,923 (GRCm39) missense probably benign
R1378:Tmem132d UTSW 5 128,346,011 (GRCm39) missense probably benign 0.43
R1741:Tmem132d UTSW 5 127,861,922 (GRCm39) missense probably benign 0.30
R1753:Tmem132d UTSW 5 127,866,919 (GRCm39) missense probably benign 0.02
R1944:Tmem132d UTSW 5 127,860,828 (GRCm39) makesense probably null
R1974:Tmem132d UTSW 5 128,346,263 (GRCm39) missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127,869,522 (GRCm39) missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127,861,505 (GRCm39) missense probably benign
R2074:Tmem132d UTSW 5 128,346,195 (GRCm39) missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127,872,987 (GRCm39) missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128,345,608 (GRCm39) missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127,941,663 (GRCm39) missense probably benign 0.09
R2902:Tmem132d UTSW 5 127,860,832 (GRCm39) missense probably benign
R3053:Tmem132d UTSW 5 127,869,538 (GRCm39) missense probably benign 0.15
R3836:Tmem132d UTSW 5 127,861,949 (GRCm39) missense probably damaging 1.00
R4127:Tmem132d UTSW 5 128,345,884 (GRCm39) missense probably benign 0.35
R4236:Tmem132d UTSW 5 128,509,389 (GRCm39) missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 128,061,405 (GRCm39) missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 128,061,360 (GRCm39) missense probably benign 0.29
R4686:Tmem132d UTSW 5 127,869,674 (GRCm39) missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 128,061,328 (GRCm39) missense probably benign 0.01
R4883:Tmem132d UTSW 5 128,346,366 (GRCm39) missense possibly damaging 0.79
R4883:Tmem132d UTSW 5 128,346,364 (GRCm39) missense probably damaging 0.99
R4939:Tmem132d UTSW 5 127,873,139 (GRCm39) missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127,873,064 (GRCm39) missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127,861,859 (GRCm39) missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127,861,964 (GRCm39) missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128,346,336 (GRCm39) missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127,861,662 (GRCm39) missense probably benign 0.13
R6048:Tmem132d UTSW 5 128,346,181 (GRCm39) missense probably benign 0.03
R6057:Tmem132d UTSW 5 127,861,934 (GRCm39) missense probably damaging 1.00
R6084:Tmem132d UTSW 5 127,861,164 (GRCm39) missense probably benign 0.06
R6505:Tmem132d UTSW 5 127,861,502 (GRCm39) missense probably benign 0.00
R6522:Tmem132d UTSW 5 127,860,832 (GRCm39) missense probably benign
R6540:Tmem132d UTSW 5 128,345,596 (GRCm39) missense possibly damaging 0.87
R7158:Tmem132d UTSW 5 128,214,083 (GRCm39) missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 128,061,415 (GRCm39) missense probably damaging 0.96
R7526:Tmem132d UTSW 5 127,861,205 (GRCm39) nonsense probably null
R7826:Tmem132d UTSW 5 127,866,953 (GRCm39) missense probably damaging 1.00
R7864:Tmem132d UTSW 5 127,860,980 (GRCm39) missense probably damaging 1.00
R8124:Tmem132d UTSW 5 127,869,624 (GRCm39) missense probably damaging 1.00
R8543:Tmem132d UTSW 5 128,345,799 (GRCm39) missense probably benign 0.00
R8694:Tmem132d UTSW 5 127,869,495 (GRCm39) missense probably benign 0.06
R8936:Tmem132d UTSW 5 127,869,676 (GRCm39) missense probably damaging 1.00
R9017:Tmem132d UTSW 5 128,346,316 (GRCm39) missense probably benign 0.00
R9017:Tmem132d UTSW 5 127,866,936 (GRCm39) missense probably benign 0.00
R9163:Tmem132d UTSW 5 127,869,570 (GRCm39) missense possibly damaging 0.82
R9257:Tmem132d UTSW 5 127,861,491 (GRCm39) nonsense probably null
R9645:Tmem132d UTSW 5 128,346,075 (GRCm39) missense probably damaging 1.00
R9667:Tmem132d UTSW 5 128,061,375 (GRCm39) missense possibly damaging 0.79
R9711:Tmem132d UTSW 5 127,869,579 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCAGGGCAAAAGTCACACAG -3'
(R):5'- AGTGAGAGTGGACACCTTGG -3'

Sequencing Primer
(F):5'- GGCAAAAGTCACACAGTTAATTAAG -3'
(R):5'- GCTGGGCTTCATGTAGAGAATATC -3'
Posted On 2018-08-01