Incidental Mutation 'R6717:Atp6v1b1'
ID529431
Institutional Source Beutler Lab
Gene Symbol Atp6v1b1
Ensembl Gene ENSMUSG00000006269
Gene NameATPase, H+ transporting, lysosomal V1 subunit B1
SynonymsAtp6b1, Vpp-3, D630039P21Rik, lysosomal 56/58kDa, Vpp3, D630030L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score184.009
Status Validated
Chromosome6
Chromosomal Location83742990-83758855 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 83753650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006431] [ENSMUST00000205763] [ENSMUST00000206911]
Predicted Effect probably null
Transcript: ENSMUST00000006431
SMART Domains Protein: ENSMUSP00000006431
Gene: ENSMUSG00000006269

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 44 110 1.9e-14 PFAM
Pfam:ATP-synt_ab 167 393 9.4e-68 PFAM
Pfam:ATP-synt_ab_C 410 508 6.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206652
Predicted Effect probably benign
Transcript: ENSMUST00000206911
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show impaired urinary acidification with a more severe metabolic acidosis and inappropriately alkaline urine after oral acid challenge. However, contrary to expectation, neither hearing nor inner ear morphology areimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Atp6v1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Atp6v1b1 APN 6 83749915 splice site probably benign
IGL02005:Atp6v1b1 APN 6 83753914 unclassified probably benign
IGL02085:Atp6v1b1 APN 6 83753915 unclassified probably benign
IGL02100:Atp6v1b1 APN 6 83758444 missense probably damaging 1.00
IGL02267:Atp6v1b1 APN 6 83756909 missense probably benign 0.44
IGL02507:Atp6v1b1 APN 6 83756855 missense possibly damaging 0.95
IGL02563:Atp6v1b1 APN 6 83755451 missense probably benign 0.14
IGL03144:Atp6v1b1 APN 6 83758351 missense probably benign 0.02
R0391:Atp6v1b1 UTSW 6 83756921 missense possibly damaging 0.93
R0420:Atp6v1b1 UTSW 6 83752844 unclassified probably benign
R0458:Atp6v1b1 UTSW 6 83752408 missense probably damaging 1.00
R0561:Atp6v1b1 UTSW 6 83753811 missense probably damaging 1.00
R0947:Atp6v1b1 UTSW 6 83753832 missense probably damaging 1.00
R1241:Atp6v1b1 UTSW 6 83756544 unclassified probably benign
R1417:Atp6v1b1 UTSW 6 83753880 missense probably damaging 1.00
R1447:Atp6v1b1 UTSW 6 83757942 missense possibly damaging 0.46
R1710:Atp6v1b1 UTSW 6 83758390 missense probably benign
R1722:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.68
R1862:Atp6v1b1 UTSW 6 83749852 critical splice acceptor site probably null
R2086:Atp6v1b1 UTSW 6 83757852 missense probably benign 0.10
R3433:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.81
R4193:Atp6v1b1 UTSW 6 83743103 missense probably benign 0.01
R4606:Atp6v1b1 UTSW 6 83752461 missense probably damaging 1.00
R5901:Atp6v1b1 UTSW 6 83758357 missense possibly damaging 0.87
R6156:Atp6v1b1 UTSW 6 83758133 missense probably damaging 1.00
R6187:Atp6v1b1 UTSW 6 83752395 missense probably damaging 1.00
R6727:Atp6v1b1 UTSW 6 83751875 unclassified probably benign
R6952:Atp6v1b1 UTSW 6 83754810 missense probably damaging 1.00
R7753:Atp6v1b1 UTSW 6 83752458 missense probably benign 0.02
R7852:Atp6v1b1 UTSW 6 83752470 missense possibly damaging 0.47
R8421:Atp6v1b1 UTSW 6 83753809 missense probably damaging 0.99
R8840:Atp6v1b1 UTSW 6 83756863 missense
Predicted Primers PCR Primer
(F):5'- ACTGTCTAGCTAAGAGCCTCAC -3'
(R):5'- GCTGTTCATGACATCAATGGGG -3'

Sequencing Primer
(F):5'- AGCTAAGAGCCTCACTTTCTCTAAGG -3'
(R):5'- TTCATGACATCAATGGGGGAGATTCC -3'
Posted On2018-08-01