Incidental Mutation 'R6717:Muc5b'
ID 529435
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Name mucin 5, subtype B, tracheobronchial
Synonyms MUC5, 2300002I04Rik, MUC9
MMRRC Submission 044835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R6717 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141392807-141426821 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 141411559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1502 (R1502*)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000165147
AA Change: R1502*
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: R1502*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,114,086 (GRCm39) L3122F probably damaging Het
Atp6v1b1 A T 6: 83,730,632 (GRCm39) probably null Het
Ccdc178 A T 18: 22,153,946 (GRCm39) V621E probably damaging Het
Cfap126 T C 1: 170,941,671 (GRCm39) probably null Het
Cog2 T C 8: 125,252,488 (GRCm39) I64T probably damaging Het
Dhx9 A C 1: 153,349,210 (GRCm39) probably null Het
Efcab7 A G 4: 99,761,931 (GRCm39) D407G possibly damaging Het
Eif2b5 G T 16: 20,324,033 (GRCm39) G459C probably damaging Het
Eml5 T C 12: 98,793,765 (GRCm39) E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,901 (GRCm39) probably benign Het
Fry A G 5: 150,419,777 (GRCm39) T980A probably benign Het
Gabbr2 A G 4: 46,787,574 (GRCm39) V363A possibly damaging Het
Ggt6 T A 11: 72,328,346 (GRCm39) L244* probably null Het
Gprc6a T A 10: 51,491,233 (GRCm39) I768F probably damaging Het
Grk1 G A 8: 13,466,237 (GRCm39) M560I probably benign Het
Hapln4 G A 8: 70,537,740 (GRCm39) E145K probably damaging Het
Hoxd9 C T 2: 74,528,733 (GRCm39) P112S probably benign Het
Ly6g6f T A 17: 35,304,550 (GRCm39) M1L probably benign Het
Mast1 T C 8: 85,644,383 (GRCm39) T849A probably benign Het
Mob4 A T 1: 55,175,872 (GRCm39) M39L possibly damaging Het
Mrgpre A T 7: 143,335,260 (GRCm39) L81Q probably damaging Het
Mst1 T C 9: 107,957,774 (GRCm39) probably null Het
Or4b13 T A 2: 90,082,868 (GRCm39) I155L probably benign Het
Or5ap2 T A 2: 85,680,567 (GRCm39) I257N probably damaging Het
Or9e1 T C 11: 58,732,113 (GRCm39) Y58H probably damaging Het
Pdc A G 1: 150,208,769 (GRCm39) D84G probably damaging Het
Peak1 T C 9: 56,114,523 (GRCm39) N443D probably benign Het
Pkd1l3 T A 8: 110,341,401 (GRCm39) W85R unknown Het
Pramel31 G T 4: 144,089,227 (GRCm39) V182L probably benign Het
Rfc1 G A 5: 65,459,347 (GRCm39) Q190* probably null Het
Rfc1 A G 5: 65,470,304 (GRCm39) S68P probably damaging Het
Rnf145 T C 11: 44,452,317 (GRCm39) V432A probably benign Het
Ror2 A G 13: 53,273,018 (GRCm39) S204P probably damaging Het
Scn1a T C 2: 66,162,631 (GRCm39) E205G probably damaging Het
Slc2a8 A C 2: 32,866,189 (GRCm39) M277R probably damaging Het
Slc4a1 T C 11: 102,245,249 (GRCm39) Y566C probably damaging Het
Slc6a12 A G 6: 121,331,262 (GRCm39) N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stk33 T A 7: 108,926,823 (GRCm39) T279S possibly damaging Het
Taok3 A G 5: 117,379,015 (GRCm39) probably benign Het
Tlr11 A G 14: 50,599,561 (GRCm39) T516A probably benign Het
Tmem132c T A 5: 127,641,093 (GRCm39) L1088Q possibly damaging Het
Tmem132d T A 5: 127,861,485 (GRCm39) M879L probably benign Het
Tnk2 A G 16: 32,489,687 (GRCm39) E322G probably damaging Het
Ttc28 T C 5: 111,433,302 (GRCm39) V2081A probably benign Het
Ttn C T 2: 76,624,753 (GRCm39) probably null Het
Zfp105 T C 9: 122,759,373 (GRCm39) V348A possibly damaging Het
Zswim2 T C 2: 83,745,753 (GRCm39) R562G probably benign Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141,395,129 (GRCm39) missense unknown
IGL00677:Muc5b APN 7 141,411,631 (GRCm39) nonsense probably null
IGL00740:Muc5b APN 7 141,409,335 (GRCm39) missense unknown
IGL01084:Muc5b APN 7 141,397,186 (GRCm39) splice site probably benign
IGL01384:Muc5b APN 7 141,400,555 (GRCm39) missense unknown
IGL01447:Muc5b APN 7 141,416,831 (GRCm39) missense probably benign 0.01
IGL01510:Muc5b APN 7 141,412,798 (GRCm39) missense unknown
IGL01532:Muc5b APN 7 141,423,743 (GRCm39) missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141,416,977 (GRCm39) missense probably benign 0.01
IGL01608:Muc5b APN 7 141,400,174 (GRCm39) missense unknown
IGL01884:Muc5b APN 7 141,421,820 (GRCm39) splice site probably benign
IGL01943:Muc5b APN 7 141,415,234 (GRCm39) missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141,424,901 (GRCm39) missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141,416,987 (GRCm39) missense probably benign 0.04
IGL02110:Muc5b APN 7 141,401,453 (GRCm39) nonsense probably null
IGL02123:Muc5b APN 7 141,417,494 (GRCm39) missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141,409,369 (GRCm39) missense unknown
IGL02141:Muc5b APN 7 141,407,104 (GRCm39) missense unknown
IGL02409:Muc5b APN 7 141,415,075 (GRCm39) missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141,422,226 (GRCm39) missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141,421,404 (GRCm39) missense probably benign 0.33
IGL02504:Muc5b APN 7 141,400,177 (GRCm39) missense unknown
IGL02528:Muc5b APN 7 141,417,754 (GRCm39) missense probably benign 0.01
IGL02534:Muc5b APN 7 141,398,456 (GRCm39) missense unknown
IGL02565:Muc5b APN 7 141,411,604 (GRCm39) missense unknown
IGL02630:Muc5b APN 7 141,416,968 (GRCm39) missense probably benign 0.03
IGL02881:Muc5b APN 7 141,411,449 (GRCm39) missense unknown
IGL02963:Muc5b APN 7 141,418,001 (GRCm39) missense probably damaging 1.00
IGL03003:Muc5b APN 7 141,417,351 (GRCm39) missense probably benign 0.03
IGL03013:Muc5b APN 7 141,417,665 (GRCm39) missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141,416,806 (GRCm39) missense probably benign 0.35
IGL03114:Muc5b APN 7 141,412,556 (GRCm39) nonsense probably null
IGL03150:Muc5b APN 7 141,419,246 (GRCm39) missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141,416,559 (GRCm39) missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141,395,117 (GRCm39) missense unknown
IGL03336:Muc5b APN 7 141,418,100 (GRCm39) missense probably damaging 1.00
IGL03370:Muc5b APN 7 141,418,514 (GRCm39) missense probably benign 0.34
IGL03375:Muc5b APN 7 141,415,699 (GRCm39) missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141,417,875 (GRCm39) missense probably benign 0.21
profligate UTSW 7 141,411,559 (GRCm39) nonsense probably null
wasteful UTSW 7 141,411,898 (GRCm39) missense unknown
R0045:Muc5b UTSW 7 141,410,555 (GRCm39) missense unknown
R0256:Muc5b UTSW 7 141,396,995 (GRCm39) missense unknown
R0256:Muc5b UTSW 7 141,395,132 (GRCm39) missense unknown
R0321:Muc5b UTSW 7 141,415,972 (GRCm39) missense probably benign 0.19
R0391:Muc5b UTSW 7 141,418,819 (GRCm39) missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141,418,709 (GRCm39) missense probably benign 0.20
R0491:Muc5b UTSW 7 141,415,752 (GRCm39) missense probably benign 0.01
R0543:Muc5b UTSW 7 141,405,522 (GRCm39) missense unknown
R0583:Muc5b UTSW 7 141,410,435 (GRCm39) nonsense probably null
R0611:Muc5b UTSW 7 141,416,173 (GRCm39) missense probably benign 0.18
R0625:Muc5b UTSW 7 141,400,164 (GRCm39) missense unknown
R0655:Muc5b UTSW 7 141,417,679 (GRCm39) missense probably benign 0.01
R0845:Muc5b UTSW 7 141,404,183 (GRCm39) splice site probably null
R0863:Muc5b UTSW 7 141,421,454 (GRCm39) missense probably benign 0.18
R0965:Muc5b UTSW 7 141,417,539 (GRCm39) missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141,425,532 (GRCm39) missense probably benign 0.03
R1140:Muc5b UTSW 7 141,412,733 (GRCm39) missense unknown
R1209:Muc5b UTSW 7 141,411,647 (GRCm39) missense unknown
R1333:Muc5b UTSW 7 141,422,144 (GRCm39) missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141,412,361 (GRCm39) missense unknown
R1385:Muc5b UTSW 7 141,415,874 (GRCm39) missense probably benign 0.00
R1463:Muc5b UTSW 7 141,412,817 (GRCm39) missense unknown
R1471:Muc5b UTSW 7 141,396,971 (GRCm39) missense unknown
R1617:Muc5b UTSW 7 141,417,261 (GRCm39) nonsense probably null
R1736:Muc5b UTSW 7 141,412,844 (GRCm39) missense unknown
R1752:Muc5b UTSW 7 141,421,488 (GRCm39) missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141,417,517 (GRCm39) missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141,419,230 (GRCm39) missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141,411,382 (GRCm39) missense unknown
R1902:Muc5b UTSW 7 141,417,842 (GRCm39) missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141,399,768 (GRCm39) missense unknown
R1924:Muc5b UTSW 7 141,421,960 (GRCm39) missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141,411,421 (GRCm39) missense unknown
R1959:Muc5b UTSW 7 141,416,374 (GRCm39) missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141,416,374 (GRCm39) missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141,416,891 (GRCm39) missense probably benign 0.01
R2080:Muc5b UTSW 7 141,423,491 (GRCm39) missense probably benign 0.33
R2178:Muc5b UTSW 7 141,417,853 (GRCm39) missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141,412,601 (GRCm39) nonsense probably null
R2229:Muc5b UTSW 7 141,415,381 (GRCm39) missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141,415,826 (GRCm39) missense probably benign 0.00
R2509:Muc5b UTSW 7 141,412,798 (GRCm39) missense unknown
R2510:Muc5b UTSW 7 141,412,798 (GRCm39) missense unknown
R2512:Muc5b UTSW 7 141,412,813 (GRCm39) missense unknown
R2888:Muc5b UTSW 7 141,415,291 (GRCm39) missense probably damaging 0.98
R3054:Muc5b UTSW 7 141,417,778 (GRCm39) missense probably damaging 0.97
R3055:Muc5b UTSW 7 141,417,778 (GRCm39) missense probably damaging 0.97
R3108:Muc5b UTSW 7 141,412,496 (GRCm39) missense unknown
R3109:Muc5b UTSW 7 141,412,496 (GRCm39) missense unknown
R3113:Muc5b UTSW 7 141,399,871 (GRCm39) missense unknown
R3551:Muc5b UTSW 7 141,415,072 (GRCm39) missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141,421,442 (GRCm39) missense probably benign 0.18
R3552:Muc5b UTSW 7 141,415,072 (GRCm39) missense possibly damaging 0.53
R3622:Muc5b UTSW 7 141,405,595 (GRCm39) splice site probably benign
R3700:Muc5b UTSW 7 141,400,986 (GRCm39) missense unknown
R3734:Muc5b UTSW 7 141,412,774 (GRCm39) nonsense probably null
R3785:Muc5b UTSW 7 141,418,853 (GRCm39) missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141,418,853 (GRCm39) missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141,417,571 (GRCm39) missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141,417,863 (GRCm39) missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141,412,918 (GRCm39) missense unknown
R3835:Muc5b UTSW 7 141,412,918 (GRCm39) missense unknown
R3850:Muc5b UTSW 7 141,416,375 (GRCm39) missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141,411,289 (GRCm39) missense unknown
R3909:Muc5b UTSW 7 141,403,235 (GRCm39) missense unknown
R3964:Muc5b UTSW 7 141,420,705 (GRCm39) missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141,417,367 (GRCm39) missense probably benign 0.40
R4015:Muc5b UTSW 7 141,417,367 (GRCm39) missense probably benign 0.40
R4017:Muc5b UTSW 7 141,417,367 (GRCm39) missense probably benign 0.40
R4042:Muc5b UTSW 7 141,418,624 (GRCm39) missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141,412,662 (GRCm39) nonsense probably null
R4230:Muc5b UTSW 7 141,417,259 (GRCm39) missense probably benign 0.03
R4400:Muc5b UTSW 7 141,415,124 (GRCm39) missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141,412,555 (GRCm39) missense unknown
R4484:Muc5b UTSW 7 141,422,187 (GRCm39) missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141,411,721 (GRCm39) missense unknown
R4646:Muc5b UTSW 7 141,416,377 (GRCm39) missense probably benign 0.34
R4658:Muc5b UTSW 7 141,395,135 (GRCm39) missense unknown
R4667:Muc5b UTSW 7 141,396,116 (GRCm39) missense unknown
R4690:Muc5b UTSW 7 141,396,031 (GRCm39) missense unknown
R4697:Muc5b UTSW 7 141,411,098 (GRCm39) missense unknown
R4711:Muc5b UTSW 7 141,399,770 (GRCm39) missense unknown
R4713:Muc5b UTSW 7 141,402,816 (GRCm39) nonsense probably null
R4749:Muc5b UTSW 7 141,415,185 (GRCm39) nonsense probably null
R4753:Muc5b UTSW 7 141,410,590 (GRCm39) missense unknown
R4782:Muc5b UTSW 7 141,401,453 (GRCm39) nonsense probably null
R4795:Muc5b UTSW 7 141,403,304 (GRCm39) missense unknown
R4796:Muc5b UTSW 7 141,417,983 (GRCm39) missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141,401,453 (GRCm39) nonsense probably null
R4824:Muc5b UTSW 7 141,417,922 (GRCm39) missense probably damaging 1.00
R4825:Muc5b UTSW 7 141,422,202 (GRCm39) missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141,412,345 (GRCm39) missense unknown
R5073:Muc5b UTSW 7 141,412,999 (GRCm39) missense unknown
R5074:Muc5b UTSW 7 141,412,999 (GRCm39) missense unknown
R5107:Muc5b UTSW 7 141,409,268 (GRCm39) missense unknown
R5152:Muc5b UTSW 7 141,419,268 (GRCm39) missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141,404,547 (GRCm39) missense unknown
R5191:Muc5b UTSW 7 141,412,276 (GRCm39) missense unknown
R5254:Muc5b UTSW 7 141,418,277 (GRCm39) missense probably benign 0.09
R5320:Muc5b UTSW 7 141,412,738 (GRCm39) missense unknown
R5352:Muc5b UTSW 7 141,418,295 (GRCm39) missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141,415,940 (GRCm39) missense unknown
R5417:Muc5b UTSW 7 141,411,781 (GRCm39) missense unknown
R5548:Muc5b UTSW 7 141,417,679 (GRCm39) missense probably benign 0.01
R5551:Muc5b UTSW 7 141,422,240 (GRCm39) missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141,400,975 (GRCm39) missense unknown
R5580:Muc5b UTSW 7 141,415,084 (GRCm39) missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141,415,036 (GRCm39) missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141,412,720 (GRCm39) missense unknown
R5783:Muc5b UTSW 7 141,412,165 (GRCm39) nonsense probably null
R5795:Muc5b UTSW 7 141,425,478 (GRCm39) missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141,411,133 (GRCm39) missense unknown
R5797:Muc5b UTSW 7 141,405,319 (GRCm39) missense unknown
R5806:Muc5b UTSW 7 141,416,572 (GRCm39) missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141,412,158 (GRCm39) missense unknown
R5910:Muc5b UTSW 7 141,415,048 (GRCm39) missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141,417,910 (GRCm39) missense probably damaging 0.99
R5970:Muc5b UTSW 7 141,410,449 (GRCm39) missense unknown
R5990:Muc5b UTSW 7 141,411,898 (GRCm39) missense unknown
R5999:Muc5b UTSW 7 141,411,116 (GRCm39) missense unknown
R6001:Muc5b UTSW 7 141,426,118 (GRCm39) missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141,418,445 (GRCm39) missense probably benign 0.07
R6073:Muc5b UTSW 7 141,412,025 (GRCm39) missense unknown
R6073:Muc5b UTSW 7 141,402,797 (GRCm39) missense unknown
R6112:Muc5b UTSW 7 141,417,042 (GRCm39) missense probably benign 0.01
R6153:Muc5b UTSW 7 141,415,181 (GRCm39) missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141,417,082 (GRCm39) missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141,412,513 (GRCm39) missense unknown
R6178:Muc5b UTSW 7 141,410,079 (GRCm39) missense probably null
R6196:Muc5b UTSW 7 141,405,333 (GRCm39) missense unknown
R6213:Muc5b UTSW 7 141,421,356 (GRCm39) missense possibly damaging 0.92
R6213:Muc5b UTSW 7 141,415,903 (GRCm39) missense probably benign 0.00
R6344:Muc5b UTSW 7 141,416,708 (GRCm39) missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141,412,402 (GRCm39) missense unknown
R6414:Muc5b UTSW 7 141,412,834 (GRCm39) missense unknown
R6521:Muc5b UTSW 7 141,412,908 (GRCm39) nonsense probably null
R6658:Muc5b UTSW 7 141,422,244 (GRCm39) critical splice donor site probably null
R6737:Muc5b UTSW 7 141,411,236 (GRCm39) missense unknown
R6763:Muc5b UTSW 7 141,416,021 (GRCm39) missense probably benign 0.01
R6817:Muc5b UTSW 7 141,416,650 (GRCm39) missense probably benign 0.06
R6819:Muc5b UTSW 7 141,412,600 (GRCm39) missense unknown
R6916:Muc5b UTSW 7 141,418,454 (GRCm39) missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141,396,192 (GRCm39) missense unknown
R7116:Muc5b UTSW 7 141,417,487 (GRCm39) missense probably benign 0.10
R7134:Muc5b UTSW 7 141,411,391 (GRCm39) missense unknown
R7146:Muc5b UTSW 7 141,417,704 (GRCm39) missense possibly damaging 0.96
R7168:Muc5b UTSW 7 141,417,754 (GRCm39) missense probably benign 0.01
R7182:Muc5b UTSW 7 141,396,382 (GRCm39) missense unknown
R7189:Muc5b UTSW 7 141,414,798 (GRCm39) nonsense probably null
R7207:Muc5b UTSW 7 141,416,602 (GRCm39) missense probably benign 0.01
R7232:Muc5b UTSW 7 141,419,866 (GRCm39) missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141,396,385 (GRCm39) missense unknown
R7269:Muc5b UTSW 7 141,411,272 (GRCm39) missense unknown
R7273:Muc5b UTSW 7 141,405,307 (GRCm39) missense unknown
R7278:Muc5b UTSW 7 141,411,239 (GRCm39) missense unknown
R7307:Muc5b UTSW 7 141,396,031 (GRCm39) missense unknown
R7323:Muc5b UTSW 7 141,412,444 (GRCm39) missense unknown
R7374:Muc5b UTSW 7 141,416,863 (GRCm39) missense probably benign 0.10
R7376:Muc5b UTSW 7 141,426,287 (GRCm39) missense possibly damaging 0.53
R7382:Muc5b UTSW 7 141,412,685 (GRCm39) missense unknown
R7481:Muc5b UTSW 7 141,414,908 (GRCm39) missense unknown
R7497:Muc5b UTSW 7 141,415,250 (GRCm39) missense possibly damaging 0.92
R7554:Muc5b UTSW 7 141,412,513 (GRCm39) missense unknown
R7571:Muc5b UTSW 7 141,400,986 (GRCm39) missense unknown
R7598:Muc5b UTSW 7 141,412,999 (GRCm39) missense unknown
R7609:Muc5b UTSW 7 141,415,466 (GRCm39) missense possibly damaging 0.86
R7615:Muc5b UTSW 7 141,418,629 (GRCm39) nonsense probably null
R7618:Muc5b UTSW 7 141,421,334 (GRCm39) missense probably benign 0.01
R7651:Muc5b UTSW 7 141,417,760 (GRCm39) missense possibly damaging 0.75
R7692:Muc5b UTSW 7 141,406,966 (GRCm39) missense unknown
R7731:Muc5b UTSW 7 141,411,042 (GRCm39) critical splice acceptor site probably null
R7746:Muc5b UTSW 7 141,415,976 (GRCm39) missense probably benign 0.10
R7748:Muc5b UTSW 7 141,401,542 (GRCm39) missense unknown
R7774:Muc5b UTSW 7 141,396,116 (GRCm39) missense unknown
R7783:Muc5b UTSW 7 141,411,078 (GRCm39) missense unknown
R7834:Muc5b UTSW 7 141,412,807 (GRCm39) missense unknown
R7872:Muc5b UTSW 7 141,399,850 (GRCm39) missense unknown
R7935:Muc5b UTSW 7 141,400,569 (GRCm39) missense unknown
R8026:Muc5b UTSW 7 141,417,373 (GRCm39) missense probably benign 0.03
R8036:Muc5b UTSW 7 141,421,478 (GRCm39) missense possibly damaging 0.73
R8081:Muc5b UTSW 7 141,417,743 (GRCm39) missense possibly damaging 0.88
R8096:Muc5b UTSW 7 141,403,292 (GRCm39) missense unknown
R8101:Muc5b UTSW 7 141,418,912 (GRCm39) missense possibly damaging 0.53
R8112:Muc5b UTSW 7 141,415,765 (GRCm39) missense possibly damaging 0.53
R8131:Muc5b UTSW 7 141,396,146 (GRCm39) missense unknown
R8170:Muc5b UTSW 7 141,414,737 (GRCm39) missense unknown
R8171:Muc5b UTSW 7 141,414,737 (GRCm39) missense unknown
R8191:Muc5b UTSW 7 141,421,421 (GRCm39) missense probably benign 0.18
R8237:Muc5b UTSW 7 141,411,697 (GRCm39) missense unknown
R8342:Muc5b UTSW 7 141,414,602 (GRCm39) missense unknown
R8343:Muc5b UTSW 7 141,417,898 (GRCm39) missense probably benign 0.28
R8389:Muc5b UTSW 7 141,415,516 (GRCm39) missense possibly damaging 0.53
R8396:Muc5b UTSW 7 141,405,552 (GRCm39) missense unknown
R8733:Muc5b UTSW 7 141,417,532 (GRCm39) missense possibly damaging 0.68
R8774:Muc5b UTSW 7 141,418,831 (GRCm39) missense probably benign 0.18
R8774-TAIL:Muc5b UTSW 7 141,418,831 (GRCm39) missense probably benign 0.18
R8833:Muc5b UTSW 7 141,412,105 (GRCm39) missense unknown
R8884:Muc5b UTSW 7 141,403,156 (GRCm39) missense unknown
R8907:Muc5b UTSW 7 141,417,875 (GRCm39) missense probably benign 0.21
R8944:Muc5b UTSW 7 141,421,115 (GRCm39) missense
R9025:Muc5b UTSW 7 141,426,209 (GRCm39) missense probably damaging 0.98
R9044:Muc5b UTSW 7 141,411,795 (GRCm39) missense unknown
R9117:Muc5b UTSW 7 141,423,070 (GRCm39) missense possibly damaging 0.73
R9145:Muc5b UTSW 7 141,411,350 (GRCm39) missense unknown
R9154:Muc5b UTSW 7 141,417,974 (GRCm39) missense probably damaging 0.98
R9177:Muc5b UTSW 7 141,399,075 (GRCm39) missense unknown
R9190:Muc5b UTSW 7 141,411,939 (GRCm39) missense unknown
R9204:Muc5b UTSW 7 141,410,129 (GRCm39) missense unknown
R9260:Muc5b UTSW 7 141,405,255 (GRCm39) missense unknown
R9331:Muc5b UTSW 7 141,411,475 (GRCm39) missense unknown
R9366:Muc5b UTSW 7 141,417,041 (GRCm39) missense probably benign 0.01
R9402:Muc5b UTSW 7 141,399,151 (GRCm39) missense unknown
R9462:Muc5b UTSW 7 141,415,216 (GRCm39) missense
R9463:Muc5b UTSW 7 141,405,503 (GRCm39) missense unknown
R9490:Muc5b UTSW 7 141,425,497 (GRCm39) missense probably benign 0.33
R9523:Muc5b UTSW 7 141,396,116 (GRCm39) missense unknown
R9548:Muc5b UTSW 7 141,421,648 (GRCm39) missense possibly damaging 0.52
R9591:Muc5b UTSW 7 141,412,516 (GRCm39) missense unknown
R9602:Muc5b UTSW 7 141,417,211 (GRCm39) missense probably benign 0.11
R9664:Muc5b UTSW 7 141,409,279 (GRCm39) missense unknown
R9703:Muc5b UTSW 7 141,425,535 (GRCm39) missense possibly damaging 0.53
R9713:Muc5b UTSW 7 141,416,678 (GRCm39) missense probably benign 0.01
R9789:Muc5b UTSW 7 141,415,330 (GRCm39) missense possibly damaging 0.95
R9800:Muc5b UTSW 7 141,415,480 (GRCm39) missense possibly damaging 0.53
Z1088:Muc5b UTSW 7 141,415,951 (GRCm39) missense probably benign 0.01
Z1176:Muc5b UTSW 7 141,396,442 (GRCm39) missense unknown
Z1177:Muc5b UTSW 7 141,416,910 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTTGGGCATAAGTACCACTCC -3'
(R):5'- GTCCACTGACATTGGGGTTG -3'

Sequencing Primer
(F):5'- GGCATAAGTACCACTCCCTCCC -3'
(R):5'- CTCAGGGCTGCTGATTGGC -3'
Posted On 2018-08-01