Incidental Mutation 'R6717:Mrgpre'
ID529436
Institutional Source Beutler Lab
Gene Symbol Mrgpre
Ensembl Gene ENSMUSG00000048965
Gene NameMAS-related GPR, member E
SynonymsMrgE, C130069N09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143778363-143784500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143781523 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 81 (L81Q)
Ref Sequence ENSEMBL: ENSMUSP00000058000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054048]
Predicted Effect probably damaging
Transcript: ENSMUST00000054048
AA Change: L81Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058000
Gene: ENSMUSG00000048965
AA Change: L81Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 29 200 7.3e-7 PFAM
transmembrane domain 210 232 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103756
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in the development but not maintenance of allodynia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Mrgpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0671:Mrgpre UTSW 7 143781517 missense probably benign
R0732:Mrgpre UTSW 7 143781566 missense possibly damaging 0.81
R3076:Mrgpre UTSW 7 143781296 missense probably benign
R4572:Mrgpre UTSW 7 143781104 missense probably damaging 1.00
R4960:Mrgpre UTSW 7 143781351 nonsense probably null
R5341:Mrgpre UTSW 7 143781509 missense probably benign
R5352:Mrgpre UTSW 7 143781094 missense probably damaging 1.00
R5920:Mrgpre UTSW 7 143781728 missense probably benign 0.00
R6178:Mrgpre UTSW 7 143780971 missense possibly damaging 0.93
R6248:Mrgpre UTSW 7 143780866 missense probably benign 0.17
R6962:Mrgpre UTSW 7 143781062 missense probably damaging 0.99
R7381:Mrgpre UTSW 7 143781413 missense probably damaging 1.00
R7574:Mrgpre UTSW 7 143781350 missense probably damaging 0.99
R8942:Mrgpre UTSW 7 143781265 missense
Predicted Primers PCR Primer
(F):5'- CTCCAAAGAACTGGGTGCAG -3'
(R):5'- GGCTTTCAACCTGACCATCC -3'

Sequencing Primer
(F):5'- TCAGCAGCAGGTCCAGTAG -3'
(R):5'- AACCTGACCATCCTGTCCC -3'
Posted On2018-08-01