Incidental Mutation 'R6717:Grk1'
ID529437
Institutional Source Beutler Lab
Gene Symbol Grk1
Ensembl Gene ENSMUSG00000031450
Gene NameG protein-coupled receptor kinase 1
SynonymsRK, Rhok
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13405081-13421951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13416237 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 560 (M560I)
Ref Sequence ENSEMBL: ENSMUSP00000147484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033827] [ENSMUST00000209909]
Predicted Effect probably benign
Transcript: ENSMUST00000033827
AA Change: M560I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033827
Gene: ENSMUSG00000031450
AA Change: M560I

DomainStartEndE-ValueType
RGS 57 175 7.34e-35 SMART
S_TKc 190 455 3.42e-81 SMART
S_TK_X 456 535 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209909
AA Change: M560I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211027
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Analysis of homozygous null mice revealed abnormal photoresponses and light-induced apoptosis in rods. Mutant mice may serve as models of Oguchi disease and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Grk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Grk1 APN 8 13413128 nonsense probably null
IGL00501:Grk1 APN 8 13407835 missense probably damaging 1.00
IGL00772:Grk1 APN 8 13405349 missense probably benign
IGL00905:Grk1 APN 8 13416068 missense probably benign 0.32
IGL01116:Grk1 APN 8 13405404 missense possibly damaging 0.52
IGL01976:Grk1 APN 8 13415993 missense probably damaging 1.00
R0463:Grk1 UTSW 8 13409279 missense probably damaging 1.00
R1600:Grk1 UTSW 8 13405406 missense probably benign 0.01
R1838:Grk1 UTSW 8 13416155 missense possibly damaging 0.77
R1911:Grk1 UTSW 8 13407923 missense probably damaging 0.99
R2122:Grk1 UTSW 8 13405221 missense probably benign 0.01
R4583:Grk1 UTSW 8 13409322 missense probably damaging 0.99
R5347:Grk1 UTSW 8 13414478 missense probably damaging 1.00
R5520:Grk1 UTSW 8 13409305 missense probably benign
R5682:Grk1 UTSW 8 13414351 missense possibly damaging 0.88
R6145:Grk1 UTSW 8 13405765 nonsense probably null
R6329:Grk1 UTSW 8 13405704 missense probably damaging 1.00
R6415:Grk1 UTSW 8 13413127 missense probably damaging 1.00
R7421:Grk1 UTSW 8 13405316 missense probably damaging 1.00
R8401:Grk1 UTSW 8 13407846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACAGTCAAGGGTGTGG -3'
(R):5'- AATAGGACTGTCATGTCTGTAGG -3'

Sequencing Primer
(F):5'- TGGTTTTTGACAAAGCGGACAC -3'
(R):5'- ACTGTCATGTCTGTAGGGTCTAGAC -3'
Posted On2018-08-01