Incidental Mutation 'R6717:Hapln4'
ID529438
Institutional Source Beutler Lab
Gene Symbol Hapln4
Ensembl Gene ENSMUSG00000007594
Gene Namehyaluronan and proteoglycan link protein 4
SynonymsBral2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70083457-70090862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70085090 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 145 (E145K)
Ref Sequence ENSEMBL: ENSMUSP00000007738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007738]
Predicted Effect probably damaging
Transcript: ENSMUST00000007738
AA Change: E145K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007738
Gene: ENSMUSG00000007594
AA Change: E145K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 60 151 6.16e-4 SMART
LINK 162 266 5.23e-44 SMART
LINK 270 363 1.33e-36 SMART
low complexity region 364 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213092
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Hapln4
AlleleSourceChrCoordTypePredicted EffectPPH Score
happen UTSW 8 70084423 unclassified probably benign
R0141:Hapln4 UTSW 8 70088280 missense probably damaging 1.00
R0331:Hapln4 UTSW 8 70084509 missense probably damaging 0.96
R0456:Hapln4 UTSW 8 70084995 missense probably benign 0.00
R0457:Hapln4 UTSW 8 70088472 nonsense probably null
R2139:Hapln4 UTSW 8 70088138 missense probably benign 0.27
R3752:Hapln4 UTSW 8 70086965 missense probably damaging 1.00
R4222:Hapln4 UTSW 8 70086960 missense probably damaging 1.00
R4863:Hapln4 UTSW 8 70084492 missense possibly damaging 0.96
R6331:Hapln4 UTSW 8 70084423 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGAAAGTGGTAGACCCTTTGG -3'
(R):5'- TGCTGATCGCTGCAAATGC -3'

Sequencing Primer
(F):5'- AAAGTGGTAGACCCTTTGGCTTTC -3'
(R):5'- TTAGGCAGGCCTTCACACAGTG -3'
Posted On2018-08-01