Mutagenetix > Incidental Mutation

Incidental Mutation 'R6717:Cog2'

529441

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

044835-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6717 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124525749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 64 (I64T)

Ref Sequence

ENSEMBL: ENSMUSP00000135022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: I64T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: I64T

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

silent
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176279
AA Change: I64T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979
AA Change: I64T

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Meta Mutation Damage Score

0.9079

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	C	T	5: 4,064,086	L3122F	probably damaging	Het
Atp6v1b1	A	T	6: 83,753,650		probably null	Het
Ccdc178	A	T	18: 22,020,889	V621E	probably damaging	Het
Cfap126	T	C	1: 171,114,102		probably null	Het
Dhx9	A	C	1: 153,473,464		probably null	Het
Efcab7	A	G	4: 99,904,734	D407G	possibly damaging	Het
Eif2b5	G	T	16: 20,505,283	G459C	probably damaging	Het
Eml5	T	C	12: 98,827,506	E1168G	probably damaging	Het
Flnc	AGCTGTCAAGTATGCTG	AGCTG	6: 29,450,902		probably benign	Het
Fry	A	G	5: 150,496,312	T980A	probably benign	Het
Gabbr2	A	G	4: 46,787,574	V363A	possibly damaging	Het
Ggt6	T	A	11: 72,437,520	L244*	probably null	Het
Gm13119	G	T	4: 144,362,657	V182L	probably benign	Het
Gprc6a	T	A	10: 51,615,137	I768F	probably damaging	Het
Grk1	G	A	8: 13,416,237	M560I	probably benign	Het
Hapln4	G	A	8: 70,085,090	E145K	probably damaging	Het
Hoxd9	C	T	2: 74,698,389	P112S	probably benign	Het
Ly6g6f	T	A	17: 35,085,574	M1L	probably benign	Het
Mast1	T	C	8: 84,917,754	T849A	probably benign	Het
Mob4	A	T	1: 55,136,713	M39L	possibly damaging	Het
Mrgpre	A	T	7: 143,781,523	L81Q	probably damaging	Het
Mst1	T	C	9: 108,080,575		probably null	Het
Muc5b	A	T	7: 141,857,822	R1502*	probably null	Het
Olfr1020	T	A	2: 85,850,223	I257N	probably damaging	Het
Olfr142	T	A	2: 90,252,524	I155L	probably benign	Het
Olfr311	T	C	11: 58,841,287	Y58H	probably damaging	Het
Pdc	A	G	1: 150,333,018	D84G	probably damaging	Het
Peak1	T	C	9: 56,207,239	N443D	probably benign	Het
Pkd1l3	T	A	8: 109,614,769	W85R	unknown	Het
Rfc1	A	G	5: 65,312,961	S68P	probably damaging	Het
Rfc1	G	A	5: 65,302,004	Q190*	probably null	Het
Rnf145	T	C	11: 44,561,490	V432A	probably benign	Het
Ror2	A	G	13: 53,118,982	S204P	probably damaging	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Slc2a8	A	C	2: 32,976,177	M277R	probably damaging	Het
Slc4a1	T	C	11: 102,354,423	Y566C	probably damaging	Het
Slc6a12	A	G	6: 121,354,303	N185S	probably benign	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stk33	T	A	7: 109,327,616	T279S	possibly damaging	Het
Taok3	A	G	5: 117,240,950		probably benign	Het
Tlr11	A	G	14: 50,362,104	T516A	probably benign	Het
Tmem132c	T	A	5: 127,564,029	L1088Q	possibly damaging	Het
Tmem132d	T	A	5: 127,784,421	M879L	probably benign	Het
Tnk2	A	G	16: 32,670,869	E322G	probably damaging	Het
Ttc28	T	C	5: 111,285,436	V2081A	probably benign	Het
Ttn	C	T	2: 76,794,409		probably null	Het
Zfp105	T	C	9: 122,930,308	V348A	possibly damaging	Het
Zswim2	T	C	2: 83,915,409	R562G	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCCCTGTAGAATGCGATCAC -3'
(R):5'- TTTACTGGGCGCTTGAACC -3'

Sequencing Primer
(F):5'- TCACAAGGAGGCACGCTTG -3'
(R):5'- CGCTTGAACCCTGAAACTGTATGG -3'

Posted On

2018-08-01