Mutagenetix > Incidental Mutation

Incidental Mutation 'R6717:Peak1'

529442

Institutional Source

Beutler Lab

Gene Symbol

Peak1

Ensembl Gene

ENSMUSG00000074305

Gene Name

pseudopodium-enriched atypical kinase 1

Synonyms

C230081A13Rik, NKF3 kinase family member, 1110049L02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R6717 (G1)

Quality Score

214.009

Status

Validated

Chromosome

Chromosomal Location

56201126-56418067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56207239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 443 (N443D)

Ref Sequence

ENSEMBL: ENSMUSP00000139985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000188142]

AlphaFold

Q69Z38

Predicted Effect

probably benign
Transcript: ENSMUST00000061552
AA Change: N1473D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: N1473D

Domain	Start	End	E-Value	Type
low complexity region	247	259	N/A	INTRINSIC
low complexity region	325	336	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	498	509	N/A	INTRINSIC
low complexity region	845	856	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	932	948	N/A	INTRINSIC
Pfam:Pkinase_Tyr	1437	1649	1.5e-6	PFAM
Pfam:Pkinase	1440	1651	2.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188142
AA Change: N443D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000139985
Gene: ENSMUSG00000074305
AA Change: N443D

Domain	Start	End	E-Value	Type
STYKc	288	622	5.5e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	C	T	5: 4,064,086	L3122F	probably damaging	Het
Atp6v1b1	A	T	6: 83,753,650		probably null	Het
Ccdc178	A	T	18: 22,020,889	V621E	probably damaging	Het
Cfap126	T	C	1: 171,114,102		probably null	Het
Cog2	T	C	8: 124,525,749	I64T	probably damaging	Het
Dhx9	A	C	1: 153,473,464		probably null	Het
Efcab7	A	G	4: 99,904,734	D407G	possibly damaging	Het
Eif2b5	G	T	16: 20,505,283	G459C	probably damaging	Het
Eml5	T	C	12: 98,827,506	E1168G	probably damaging	Het
Flnc	AGCTGTCAAGTATGCTG	AGCTG	6: 29,450,902		probably benign	Het
Fry	A	G	5: 150,496,312	T980A	probably benign	Het
Gabbr2	A	G	4: 46,787,574	V363A	possibly damaging	Het
Ggt6	T	A	11: 72,437,520	L244*	probably null	Het
Gm13119	G	T	4: 144,362,657	V182L	probably benign	Het
Gprc6a	T	A	10: 51,615,137	I768F	probably damaging	Het
Grk1	G	A	8: 13,416,237	M560I	probably benign	Het
Hapln4	G	A	8: 70,085,090	E145K	probably damaging	Het
Hoxd9	C	T	2: 74,698,389	P112S	probably benign	Het
Ly6g6f	T	A	17: 35,085,574	M1L	probably benign	Het
Mast1	T	C	8: 84,917,754	T849A	probably benign	Het
Mob4	A	T	1: 55,136,713	M39L	possibly damaging	Het
Mrgpre	A	T	7: 143,781,523	L81Q	probably damaging	Het
Mst1	T	C	9: 108,080,575		probably null	Het
Muc5b	A	T	7: 141,857,822	R1502*	probably null	Het
Olfr1020	T	A	2: 85,850,223	I257N	probably damaging	Het
Olfr142	T	A	2: 90,252,524	I155L	probably benign	Het
Olfr311	T	C	11: 58,841,287	Y58H	probably damaging	Het
Pdc	A	G	1: 150,333,018	D84G	probably damaging	Het
Pkd1l3	T	A	8: 109,614,769	W85R	unknown	Het
Rfc1	G	A	5: 65,302,004	Q190*	probably null	Het
Rfc1	A	G	5: 65,312,961	S68P	probably damaging	Het
Rnf145	T	C	11: 44,561,490	V432A	probably benign	Het
Ror2	A	G	13: 53,118,982	S204P	probably damaging	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Slc2a8	A	C	2: 32,976,177	M277R	probably damaging	Het
Slc4a1	T	C	11: 102,354,423	Y566C	probably damaging	Het
Slc6a12	A	G	6: 121,354,303	N185S	probably benign	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stk33	T	A	7: 109,327,616	T279S	possibly damaging	Het
Taok3	A	G	5: 117,240,950		probably benign	Het
Tlr11	A	G	14: 50,362,104	T516A	probably benign	Het
Tmem132c	T	A	5: 127,564,029	L1088Q	possibly damaging	Het
Tmem132d	T	A	5: 127,784,421	M879L	probably benign	Het
Tnk2	A	G	16: 32,670,869	E322G	probably damaging	Het
Ttc28	T	C	5: 111,285,436	V2081A	probably benign	Het
Ttn	C	T	2: 76,794,409		probably null	Het
Zfp105	T	C	9: 122,930,308	V348A	possibly damaging	Het
Zswim2	T	C	2: 83,915,409	R562G	probably benign	Het

Other mutations in Peak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Peak1	APN	9	56227326	missense	probably damaging	1.00
IGL00544:Peak1	APN	9	56259978	missense	probably damaging	1.00
IGL01141:Peak1	APN	9	56258527	missense	probably benign	0.01
IGL01743:Peak1	APN	9	56259202	missense	probably damaging	1.00
IGL01781:Peak1	APN	9	56260065	missense	possibly damaging	0.92
IGL01885:Peak1	APN	9	56260104	missense	probably damaging	1.00
IGL01941:Peak1	APN	9	56258775	missense	probably damaging	1.00
IGL02455:Peak1	APN	9	56227473	missense	possibly damaging	0.89
IGL02719:Peak1	APN	9	56227206	missense	probably damaging	1.00
IGL03247:Peak1	APN	9	56257930	missense	probably damaging	1.00
IGL03259:Peak1	APN	9	56259967	missense	probably damaging	1.00
R0060:Peak1	UTSW	9	56227823	missense	probably damaging	1.00
R0087:Peak1	UTSW	9	56258325	missense	probably damaging	1.00
R0480:Peak1	UTSW	9	56258632	missense	probably benign	0.00
R0569:Peak1	UTSW	9	56260089	missense	probably damaging	1.00
R0605:Peak1	UTSW	9	56227098	splice site	probably benign
R0865:Peak1	UTSW	9	56257832	missense	probably benign	0.02
R1117:Peak1	UTSW	9	56258418	missense	probably benign	0.05
R1922:Peak1	UTSW	9	56206687	missense	probably damaging	1.00
R1959:Peak1	UTSW	9	56206789	missense	probably damaging	1.00
R2069:Peak1	UTSW	9	56258759	missense	probably damaging	1.00
R2083:Peak1	UTSW	9	56258949	missense	probably damaging	1.00
R2154:Peak1	UTSW	9	56207212	missense	probably damaging	1.00
R2407:Peak1	UTSW	9	56259226	missense	probably damaging	1.00
R3832:Peak1	UTSW	9	56258383	missense	probably benign
R3938:Peak1	UTSW	9	56260365	missense	probably benign	0.01
R3964:Peak1	UTSW	9	56259979	missense	probably damaging	1.00
R4192:Peak1	UTSW	9	56258741	missense	probably damaging	1.00
R4381:Peak1	UTSW	9	56258427	missense	probably benign	0.34
R4869:Peak1	UTSW	9	56227592	missense	probably benign	0.06
R4994:Peak1	UTSW	9	56241276	missense	possibly damaging	0.65
R5062:Peak1	UTSW	9	56260289	missense	probably damaging	1.00
R5435:Peak1	UTSW	9	56206486	missense	probably damaging	0.98
R5632:Peak1	UTSW	9	56257774	missense	probably damaging	1.00
R5643:Peak1	UTSW	9	56258755	missense	probably damaging	0.99
R5880:Peak1	UTSW	9	56207610	missense	probably damaging	1.00
R5898:Peak1	UTSW	9	56207338	missense	probably benign	0.19
R5986:Peak1	UTSW	9	56259442	missense	probably benign	0.00
R6109:Peak1	UTSW	9	56259283	missense	probably benign	0.01
R6284:Peak1	UTSW	9	56260296	missense	probably benign	0.10
R6347:Peak1	UTSW	9	56258211	missense	probably benign	0.00
R6374:Peak1	UTSW	9	56257666	missense	probably damaging	1.00
R6471:Peak1	UTSW	9	56258259	missense	probably damaging	1.00
R7033:Peak1	UTSW	9	56259707	missense	probably damaging	1.00
R7039:Peak1	UTSW	9	56257809	missense	probably benign	0.01
R7100:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R7604:Peak1	UTSW	9	56241207	nonsense	probably null
R7868:Peak1	UTSW	9	56260470	missense	probably damaging	1.00
R7979:Peak1	UTSW	9	56207392	missense	possibly damaging	0.52
R8258:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8259:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8272:Peak1	UTSW	9	56258898	missense	probably damaging	1.00
R8324:Peak1	UTSW	9	56207476	missense	probably damaging	1.00
R8516:Peak1	UTSW	9	56260000	missense	probably damaging	1.00
R8847:Peak1	UTSW	9	56207143	missense	probably damaging	1.00
R8895:Peak1	UTSW	9	56206654	missense	probably benign
R9082:Peak1	UTSW	9	56258220	missense	probably benign	0.07
R9138:Peak1	UTSW	9	56257641	missense	probably benign	0.34
R9355:Peak1	UTSW	9	56260170	missense	probably damaging	1.00
R9548:Peak1	UTSW	9	56206633	missense	probably benign	0.19
R9591:Peak1	UTSW	9	56259550	missense	possibly damaging	0.48
R9642:Peak1	UTSW	9	56259921	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGCCTGAGAGAAGTTACTCAC -3'
(R):5'- TGCTCCTGAAAAGGCAGAGG -3'

Sequencing Primer
(F):5'- TCACAATGAGCCTTGTAGGAC -3'
(R):5'- TGGCACTGAAGACAGCG -3'

Posted On

2018-08-01