Incidental Mutation 'R6717:Zfp105'
ID529443
Institutional Source Beutler Lab
Gene Symbol Zfp105
Ensembl Gene ENSMUSG00000057895
Gene Namezinc finger protein 105
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122923072-122931028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122930308 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 348 (V348A)
Ref Sequence ENSEMBL: ENSMUSP00000079840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051667] [ENSMUST00000148851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051667
AA Change: V348A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079840
Gene: ENSMUSG00000057895
AA Change: V348A

DomainStartEndE-ValueType
ZnF_C2H2 219 241 4.54e-4 SMART
ZnF_C2H2 247 269 1.69e-3 SMART
ZnF_C2H2 275 297 1.2e-3 SMART
ZnF_C2H2 303 325 7.9e-4 SMART
ZnF_C2H2 331 353 7.49e-5 SMART
ZnF_C2H2 359 381 1.82e-3 SMART
ZnF_C2H2 387 409 5.42e-2 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 443 465 4.79e-3 SMART
ZnF_C2H2 471 493 9.22e-5 SMART
ZnF_C2H2 499 521 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal spermatogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Zfp105
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1416:Zfp105 UTSW 9 122930677 missense probably damaging 1.00
R1717:Zfp105 UTSW 9 122930631 missense probably damaging 1.00
R2119:Zfp105 UTSW 9 122929678 nonsense probably null
R4522:Zfp105 UTSW 9 122930056 missense possibly damaging 0.88
R4953:Zfp105 UTSW 9 122929815 missense probably benign 0.10
R5523:Zfp105 UTSW 9 122926389 missense probably benign 0.00
R6943:Zfp105 UTSW 9 122925238 missense probably benign
R7102:Zfp105 UTSW 9 122929804 missense probably damaging 1.00
R7827:Zfp105 UTSW 9 122930743 missense probably damaging 1.00
R8065:Zfp105 UTSW 9 122925129 missense probably benign
R8823:Zfp105 UTSW 9 122930503 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCAGAGTGCAAATCTTGTTGTG -3'
(R):5'- AAAGCTGCACCACACTTTGC -3'

Sequencing Primer
(F):5'- AAGTGCAAACCTCGTTGTGC -3'
(R):5'- TATGAGCTACAAGTGAAGGCCTTCC -3'
Posted On2018-08-01