Incidental Mutation 'R6717:Ggt6'
ID529447
Institutional Source Beutler Lab
Gene Symbol Ggt6
Ensembl Gene ENSMUSG00000040471
Gene Namegamma-glutamyltransferase 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72435526-72438400 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72437520 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 244 (L244*)
Ref Sequence ENSEMBL: ENSMUSP00000098463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633] [ENSMUST00000076443] [ENSMUST00000100903] [ENSMUST00000108499]
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076443
AA Change: L282*
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471
AA Change: L282*

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100903
AA Change: L244*
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471
AA Change: L244*

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108499
SMART Domains Protein: ENSMUSP00000104139
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Ggt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Ggt6 APN 11 72436806 missense possibly damaging 0.51
hallo UTSW 11 72437667 missense probably damaging 0.98
IGL03097:Ggt6 UTSW 11 72436813 missense possibly damaging 0.71
R0080:Ggt6 UTSW 11 72437195 missense possibly damaging 0.92
R0178:Ggt6 UTSW 11 72436818 missense possibly damaging 0.71
R0595:Ggt6 UTSW 11 72437667 missense probably damaging 0.98
R0842:Ggt6 UTSW 11 72437262 nonsense probably null
R1131:Ggt6 UTSW 11 72435680 missense possibly damaging 0.82
R1606:Ggt6 UTSW 11 72437733 missense possibly damaging 0.92
R2029:Ggt6 UTSW 11 72437541 missense possibly damaging 0.90
R2359:Ggt6 UTSW 11 72437551 missense possibly damaging 0.92
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R4462:Ggt6 UTSW 11 72437828 missense possibly damaging 0.52
R4608:Ggt6 UTSW 11 72437943 missense probably benign 0.04
R4735:Ggt6 UTSW 11 72436599 missense probably benign
R5431:Ggt6 UTSW 11 72437738 missense possibly damaging 0.71
R5648:Ggt6 UTSW 11 72435716 missense possibly damaging 0.46
R6390:Ggt6 UTSW 11 72436611 missense possibly damaging 0.86
R7506:Ggt6 UTSW 11 72437898 missense possibly damaging 0.73
R7798:Ggt6 UTSW 11 72435541 start gained probably benign
Z1177:Ggt6 UTSW 11 72436599 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGATGCACCCCTGGCAAAC -3'
(R):5'- ACTGCTCACTGGGGTTTCAG -3'

Sequencing Primer
(F):5'- ACGCACTAGCCATCCAGGG -3'
(R):5'- AGCAGAGCTGGGTGTCCTG -3'
Posted On2018-08-01