Mutagenetix > Incidental Mutations

Incidental Mutation 'R6717:Ror2'

529450

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6717 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53118982 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 204 (S204P)

Ref Sequence

ENSEMBL: ENSMUSP00000123362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021918
AA Change: S216P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: S216P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130235
AA Change: S204P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: S204P

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Meta Mutation Damage Score

0.8093

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	C	T	5: 4,064,086	L3122F	probably damaging	Het
Atp6v1b1	A	T	6: 83,753,650		probably null	Het
Ccdc178	A	T	18: 22,020,889	V621E	probably damaging	Het
Cfap126	T	C	1: 171,114,102		probably null	Het
Cog2	T	C	8: 124,525,749	I64T	probably damaging	Het
Dhx9	A	C	1: 153,473,464		probably null	Het
Efcab7	A	G	4: 99,904,734	D407G	possibly damaging	Het
Eif2b5	G	T	16: 20,505,283	G459C	probably damaging	Het
Eml5	T	C	12: 98,827,506	E1168G	probably damaging	Het
Flnc	AGCTGTCAAGTATGCTG	AGCTG	6: 29,450,902		probably benign	Het
Fry	A	G	5: 150,496,312	T980A	probably benign	Het
Gabbr2	A	G	4: 46,787,574	V363A	possibly damaging	Het
Ggt6	T	A	11: 72,437,520	L244*	probably null	Het
Gm13119	G	T	4: 144,362,657	V182L	probably benign	Het
Gprc6a	T	A	10: 51,615,137	I768F	probably damaging	Het
Grk1	G	A	8: 13,416,237	M560I	probably benign	Het
Hapln4	G	A	8: 70,085,090	E145K	probably damaging	Het
Hoxd9	C	T	2: 74,698,389	P112S	probably benign	Het
Ly6g6f	T	A	17: 35,085,574	M1L	probably benign	Het
Mast1	T	C	8: 84,917,754	T849A	probably benign	Het
Mob4	A	T	1: 55,136,713	M39L	possibly damaging	Het
Mrgpre	A	T	7: 143,781,523	L81Q	probably damaging	Het
Mst1	T	C	9: 108,080,575		probably null	Het
Muc5b	A	T	7: 141,857,822	R1502*	probably null	Het
Olfr1020	T	A	2: 85,850,223	I257N	probably damaging	Het
Olfr142	T	A	2: 90,252,524	I155L	probably benign	Het
Olfr311	T	C	11: 58,841,287	Y58H	probably damaging	Het
Pdc	A	G	1: 150,333,018	D84G	probably damaging	Het
Peak1	T	C	9: 56,207,239	N443D	probably benign	Het
Pkd1l3	T	A	8: 109,614,769	W85R	unknown	Het
Rfc1	A	G	5: 65,312,961	S68P	probably damaging	Het
Rfc1	G	A	5: 65,302,004	Q190*	probably null	Het
Rnf145	T	C	11: 44,561,490	V432A	probably benign	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Slc2a8	A	C	2: 32,976,177	M277R	probably damaging	Het
Slc4a1	T	C	11: 102,354,423	Y566C	probably damaging	Het
Slc6a12	A	G	6: 121,354,303	N185S	probably benign	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stk33	T	A	7: 109,327,616	T279S	possibly damaging	Het
Taok3	A	G	5: 117,240,950		probably benign	Het
Tlr11	A	G	14: 50,362,104	T516A	probably benign	Het
Tmem132c	T	A	5: 127,564,029	L1088Q	possibly damaging	Het
Tmem132d	T	A	5: 127,784,421	M879L	probably benign	Het
Tnk2	A	G	16: 32,670,869	E322G	probably damaging	Het
Ttc28	T	C	5: 111,285,436	V2081A	probably benign	Het
Ttn	C	T	2: 76,794,409		probably null	Het
Zfp105	T	C	9: 122,930,308	V348A	possibly damaging	Het
Zswim2	T	C	2: 83,915,409	R562G	probably benign	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
lavage	UTSW	13	53118982	missense	probably damaging	1.00
tendrils	UTSW	13	53111451	missense	probably damaging	0.96
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00
R8479:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R8684:Ror2	UTSW	13	53110266	missense	possibly damaging	0.90
R8834:Ror2	UTSW	13	53110302	small deletion	probably benign
R8948:Ror2	UTSW	13	53131996	missense	possibly damaging	0.67
R9233:Ror2	UTSW	13	53111554	missense	probably benign
R9234:Ror2	UTSW	13	53111338	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGATGACACTCACAGCG -3'
(R):5'- GGACCAAGATTAGGGGCTTC -3'

Sequencing Primer
(F):5'- TTCGCACTTGGGCAGCTG -3'
(R):5'- CAAGATTAGGGGCTTCAGGGTTTG -3'

Posted On

2018-08-01