Incidental Mutation 'R6717:Eif2b5'
ID529452
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20505283 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 459 (G459C)
Ref Sequence ENSEMBL: ENSMUSP00000003320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320] [ENSMUST00000148714]
Predicted Effect probably damaging
Transcript: ENSMUST00000003320
AA Change: G459C

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: G459C

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148714
SMART Domains Protein: ENSMUSP00000121169
Gene: ENSMUSG00000003235

DomainStartEndE-ValueType
Pfam:W2 82 150 7e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231315
AA Change: G38C
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R2231:Eif2b5 UTSW 16 20504770 missense probably benign
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4423:Eif2b5 UTSW 16 20501719 missense probably benign 0.10
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5920:Eif2b5 UTSW 16 20498944 missense unknown
R5925:Eif2b5 UTSW 16 20508124 missense probably benign 0.02
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
R8046:Eif2b5 UTSW 16 20506404 missense possibly damaging 0.88
R8196:Eif2b5 UTSW 16 20502556 missense probably damaging 0.99
R8503:Eif2b5 UTSW 16 20498980 missense probably benign 0.23
R8532:Eif2b5 UTSW 16 20505206 missense probably damaging 0.99
Z1187:Eif2b5 UTSW 16 20498921 missense unknown
Z1192:Eif2b5 UTSW 16 20498921 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGATTGTCAAGACACAGTTCTC -3'
(R):5'- ACTGACTTTGAGAAGGCCCAG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- GCAGCAGCATCTCTCTCTAGAAGG -3'
Posted On2018-08-01