Incidental Mutation 'R6717:Ly6g6f'
ID529454
Institutional Source Beutler Lab
Gene Symbol Ly6g6f
Ensembl Gene ENSMUSG00000034923
Gene Namelymphocyte antigen 6 complex, locus G6F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35080480-35085610 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 35085574 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000046380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000038507] [ENSMUST00000173846]
Predicted Effect probably benign
Transcript: ENSMUST00000007251
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038507
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046380
Gene: ENSMUSG00000034923
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 21 127 6.02e-7 SMART
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173134
SMART Domains Protein: ENSMUSP00000133278
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173190
Predicted Effect probably benign
Transcript: ENSMUST00000173846
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human G6f protein is a type I transmembrane protein belonging to the immunoglobin (Ig) superfamily, which is comprised of cell-surface proteins involved in the immune system and cellular recognition (de Vet et al., 2003 [PubMed 12852788]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Ly6g6f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Ly6g6f APN 17 35080841 unclassified probably benign
IGL01804:Ly6g6f APN 17 35081170 missense possibly damaging 0.85
IGL02280:Ly6g6f APN 17 35083218 missense probably benign 0.06
IGL02455:Ly6g6f APN 17 35082890 missense possibly damaging 0.91
IGL02694:Ly6g6f APN 17 35081168 missense possibly damaging 0.96
R0519:Ly6g6f UTSW 17 35082852 missense possibly damaging 0.53
R1169:Ly6g6f UTSW 17 35083264 missense probably damaging 0.99
R1796:Ly6g6f UTSW 17 35083502 missense probably benign 0.02
R5549:Ly6g6f UTSW 17 35083357 missense possibly damaging 0.51
R8012:Ly6g6f UTSW 17 35081084 missense possibly damaging 0.53
X0017:Ly6g6f UTSW 17 35085538 missense probably benign 0.17
X0027:Ly6g6f UTSW 17 35081120 missense probably benign 0.03
Z1177:Ly6g6f UTSW 17 35083032 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGCAAGGTCAGTCTGTCTTC -3'
(R):5'- TGGGATTCCTTGCACACGAG -3'

Sequencing Primer
(F):5'- AAGGTCAGTCTGTCTTCTTGAGTCAC -3'
(R):5'- GATTCCTTGCACACGAGAGCAG -3'
Posted On2018-08-01