Incidental Mutation 'R6718:Pigu'
ID529457
Institutional Source Beutler Lab
Gene Symbol Pigu
Ensembl Gene ENSMUSG00000038383
Gene Namephosphatidylinositol glycan anchor biosynthesis, class U
SynonymsCdc91l1, 5430426F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155278243-155357430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155301286 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 232 (Y232H)
Ref Sequence ENSEMBL: ENSMUSP00000126236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect probably benign
Transcript: ENSMUST00000077626
AA Change: Y233H

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383
AA Change: Y233H

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139854
Predicted Effect possibly damaging
Transcript: ENSMUST00000165234
AA Change: Y232H

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383
AA Change: Y232H

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Hoxc5 A G 15: 103,014,266 probably null Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Mrgpra3 C T 7: 47,589,696 V161M probably benign Het
Olfr853 G T 9: 19,537,199 H244N probably damaging Het
Otx1 T C 11: 21,996,412 probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Slc30a9 T C 5: 67,333,100 V218A probably damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Pigu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Pigu APN 2 155331192 missense possibly damaging 0.70
IGL02833:Pigu APN 2 155345645 splice site probably benign
IGL03213:Pigu APN 2 155335371 missense probably damaging 1.00
R1645:Pigu UTSW 2 155328678 nonsense probably null
R2426:Pigu UTSW 2 155299082 missense probably damaging 1.00
R3816:Pigu UTSW 2 155299143 missense probably damaging 1.00
R3879:Pigu UTSW 2 155299143 missense probably damaging 1.00
R5017:Pigu UTSW 2 155299208 intron probably null
R5215:Pigu UTSW 2 155335329 intron probably benign
R5557:Pigu UTSW 2 155278629 nonsense probably null
R6106:Pigu UTSW 2 155297196 missense possibly damaging 0.67
R7140:Pigu UTSW 2 155301240 missense possibly damaging 0.78
R7358:Pigu UTSW 2 155299170 missense probably damaging 1.00
R7467:Pigu UTSW 2 155299089 missense probably damaging 1.00
R7503:Pigu UTSW 2 155331144 splice site probably null
R7844:Pigu UTSW 2 155292720 nonsense probably null
R7927:Pigu UTSW 2 155292720 nonsense probably null
Z1177:Pigu UTSW 2 155299148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAGAGGCTCCCTTAAAGG -3'
(R):5'- GTAAAGTTTTGTGACATGGCTTG -3'

Sequencing Primer
(F):5'- CCCTTAAAGGATGAGGACCCTTTTTG -3'
(R):5'- GGTTTTATAGGAAGGATCTTCATGC -3'
Posted On2018-08-01