Incidental Mutation 'R6718:Slc30a9'
ID529458
Institutional Source Beutler Lab
Gene Symbol Slc30a9
Ensembl Gene ENSMUSG00000029221
Gene Namesolute carrier family 30 (zinc transporter), member 9
Synonyms2310024J23Rik, GAC63
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location67306955-67358443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67333100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000109306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113676] [ENSMUST00000162372] [ENSMUST00000202521]
Predicted Effect probably damaging
Transcript: ENSMUST00000113676
AA Change: V218A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109306
Gene: ENSMUSG00000029221
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 103 196 2e-54 PDB
SCOP:d1d4ua1 106 174 3e-28 SMART
Pfam:Cation_efflux 219 547 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161169
Predicted Effect probably damaging
Transcript: ENSMUST00000162372
AA Change: V238A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124047
Gene: ENSMUSG00000029221
AA Change: V238A

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 123 216 2e-54 PDB
SCOP:d1d4ua1 126 194 5e-28 SMART
Pfam:Cation_efflux 239 449 1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200734
Predicted Effect probably benign
Transcript: ENSMUST00000202521
Predicted Effect probably benign
Transcript: ENSMUST00000202770
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Hoxc5 A G 15: 103,014,266 probably null Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Mrgpra3 C T 7: 47,589,696 V161M probably benign Het
Olfr853 G T 9: 19,537,199 H244N probably damaging Het
Otx1 T C 11: 21,996,412 probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pigu A G 2: 155,301,286 Y232H possibly damaging Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Slc30a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc30a9 APN 5 67342109 missense probably damaging 1.00
IGL00975:Slc30a9 APN 5 67349826 missense probably damaging 1.00
IGL01129:Slc30a9 APN 5 67342143 missense probably damaging 1.00
IGL01377:Slc30a9 APN 5 67315830 missense probably benign
IGL01785:Slc30a9 APN 5 67346238 splice site probably benign
IGL01786:Slc30a9 APN 5 67346238 splice site probably benign
IGL02407:Slc30a9 APN 5 67352722 missense probably damaging 1.00
IGL03185:Slc30a9 APN 5 67333063 missense probably benign
IGL03276:Slc30a9 APN 5 67349917 splice site probably benign
IGL03380:Slc30a9 APN 5 67315711 missense probably benign 0.04
ANU74:Slc30a9 UTSW 5 67349852 missense probably damaging 1.00
R0539:Slc30a9 UTSW 5 67334610 missense probably damaging 1.00
R1401:Slc30a9 UTSW 5 67352662 missense probably benign
R1554:Slc30a9 UTSW 5 67326921 missense probably damaging 1.00
R1824:Slc30a9 UTSW 5 67348052 missense probably damaging 1.00
R2029:Slc30a9 UTSW 5 67339975 nonsense probably null
R4385:Slc30a9 UTSW 5 67315767 missense probably damaging 1.00
R4704:Slc30a9 UTSW 5 67342273 intron probably benign
R4868:Slc30a9 UTSW 5 67324683 missense probably benign
R4907:Slc30a9 UTSW 5 67346162 missense probably damaging 1.00
R5553:Slc30a9 UTSW 5 67345604 intron probably null
R6002:Slc30a9 UTSW 5 67342117 missense probably damaging 1.00
R6477:Slc30a9 UTSW 5 67328524 missense probably benign 0.01
R7113:Slc30a9 UTSW 5 67326862 missense probably benign 0.17
R7224:Slc30a9 UTSW 5 67315701 missense probably benign
R7327:Slc30a9 UTSW 5 67342119 missense probably damaging 1.00
R7394:Slc30a9 UTSW 5 67352766 critical splice donor site probably null
R7467:Slc30a9 UTSW 5 67345644 missense probably benign 0.08
R7514:Slc30a9 UTSW 5 67348078 missense possibly damaging 0.68
R8020:Slc30a9 UTSW 5 67307033 start gained probably benign
Z1176:Slc30a9 UTSW 5 67339958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTTTAAAGAGAGATGTTGGATG -3'
(R):5'- CCCAAATCAAATGTCCATAGGG -3'

Sequencing Primer
(F):5'- GAAAAGAATTTGATAGCAAGCCTCC -3'
(R):5'- TATCATTTCACTGGGCCACAAC -3'
Posted On2018-08-01