Incidental Mutation 'R6718:Mrgpra3'
ID529460
Institutional Source Beutler Lab
Gene Symbol Mrgpra3
Ensembl Gene ENSMUSG00000078698
Gene NameMAS-related GPR, member A3
SynonymsG protein-coupled receptor, MrgA3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location47588950-47601372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47589696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 161 (V161M)
Ref Sequence ENSEMBL: ENSMUSP00000135437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176369]
Predicted Effect probably benign
Transcript: ENSMUST00000176369
AA Change: V161M

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135437
Gene: ENSMUSG00000078698
AA Change: V161M

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 234 6.3e-7 PFAM
Pfam:7tm_1 57 286 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Hoxc5 A G 15: 103,014,266 probably null Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Olfr853 G T 9: 19,537,199 H244N probably damaging Het
Otx1 T C 11: 21,996,412 probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pigu A G 2: 155,301,286 Y232H possibly damaging Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Slc30a9 T C 5: 67,333,100 V218A probably damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Mrgpra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mrgpra3 APN 7 47589519 missense probably benign 0.00
IGL02097:Mrgpra3 APN 7 47589456 missense possibly damaging 0.94
IGL02101:Mrgpra3 APN 7 47589552 missense probably damaging 0.99
IGL03071:Mrgpra3 APN 7 47589181 utr 3 prime probably benign
PIT4445001:Mrgpra3 UTSW 7 47590160 missense possibly damaging 0.88
R0828:Mrgpra3 UTSW 7 47590136 missense probably benign 0.12
R1118:Mrgpra3 UTSW 7 47589291 missense possibly damaging 0.83
R1835:Mrgpra3 UTSW 7 47589946 nonsense probably null
R2258:Mrgpra3 UTSW 7 47590094 missense probably benign 0.35
R2393:Mrgpra3 UTSW 7 47589617 missense possibly damaging 0.92
R3437:Mrgpra3 UTSW 7 47589566 missense probably damaging 1.00
R3973:Mrgpra3 UTSW 7 47589666 missense probably benign 0.22
R4273:Mrgpra3 UTSW 7 47589432 missense probably benign 0.01
R4495:Mrgpra3 UTSW 7 47590065 missense probably benign 0.00
R4768:Mrgpra3 UTSW 7 47589728 missense possibly damaging 0.94
R4822:Mrgpra3 UTSW 7 47589968 missense possibly damaging 0.69
R4967:Mrgpra3 UTSW 7 47589519 missense probably benign 0.33
R5207:Mrgpra3 UTSW 7 47590161 missense probably benign 0.06
R5569:Mrgpra3 UTSW 7 47590011 missense probably benign 0.00
R5763:Mrgpra3 UTSW 7 47589607 nonsense probably null
R6102:Mrgpra3 UTSW 7 47590149 missense possibly damaging 0.92
R6612:Mrgpra3 UTSW 7 47590035 missense probably benign 0.00
R6859:Mrgpra3 UTSW 7 47590033 missense probably benign 0.04
R7029:Mrgpra3 UTSW 7 47589542 missense probably benign 0.00
R7034:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7036:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7097:Mrgpra3 UTSW 7 47589641 missense probably benign
R7475:Mrgpra3 UTSW 7 47589947 missense probably damaging 1.00
R8289:Mrgpra3 UTSW 7 47589720 missense possibly damaging 0.76
R8315:Mrgpra3 UTSW 7 47601303 start codon destroyed probably null 0.93
Z1177:Mrgpra3 UTSW 7 47601301 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGGTCAGCATGATGGTCAC -3'
(R):5'- TCTCAAGTTTACCCTACCCAAAGG -3'

Sequencing Primer
(F):5'- GTCAGCATGATGGTCACGAATAATC -3'
(R):5'- TACCCTACCCAAAGGAATTTTTGC -3'
Posted On2018-08-01