Incidental Mutation 'R6718:Olfr853'
ID529464
Institutional Source Beutler Lab
Gene Symbol Olfr853
Ensembl Gene ENSMUSG00000051160
Gene Nameolfactory receptor 853
SynonymsMOR154-1, GA_x6K02T2PVTD-13277703-13276786
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19534202-19541076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19537199 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 244 (H244N)
Ref Sequence ENSEMBL: ENSMUSP00000150773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058296] [ENSMUST00000213834]
Predicted Effect probably damaging
Transcript: ENSMUST00000058296
AA Change: H244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053262
Gene: ENSMUSG00000051160
AA Change: H244N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 206 1.7e-7 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212273
Predicted Effect probably damaging
Transcript: ENSMUST00000213834
AA Change: H244N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Hoxc5 A G 15: 103,014,266 probably null Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Mrgpra3 C T 7: 47,589,696 V161M probably benign Het
Otx1 T C 11: 21,996,412 probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pigu A G 2: 155,301,286 Y232H possibly damaging Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Slc30a9 T C 5: 67,333,100 V218A probably damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Olfr853
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Olfr853 APN 9 19537852 missense possibly damaging 0.94
IGL02078:Olfr853 APN 9 19537453 missense probably benign 0.14
IGL02092:Olfr853 APN 9 19537750 missense probably damaging 0.99
IGL02728:Olfr853 APN 9 19537846 missense possibly damaging 0.95
R0245:Olfr853 UTSW 9 19537112 missense probably benign 0.01
R1331:Olfr853 UTSW 9 19537546 missense probably benign 0.03
R1661:Olfr853 UTSW 9 19537328 missense probably benign 0.00
R1696:Olfr853 UTSW 9 19537894 missense probably damaging 1.00
R2004:Olfr853 UTSW 9 19537392 nonsense probably null
R2182:Olfr853 UTSW 9 19537342 missense probably benign 0.24
R3730:Olfr853 UTSW 9 19537151 missense probably benign 0.01
R4002:Olfr853 UTSW 9 19537906 missense probably benign 0.00
R4627:Olfr853 UTSW 9 19537673 missense possibly damaging 0.86
R5027:Olfr853 UTSW 9 19537277 missense probably damaging 1.00
R5486:Olfr853 UTSW 9 19537294 missense probably benign
R5931:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R6229:Olfr853 UTSW 9 19537718 missense possibly damaging 0.91
R6564:Olfr853 UTSW 9 19537210 missense possibly damaging 0.95
R7247:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R7347:Olfr853 UTSW 9 19537099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCCTTGTTAGACATCAGTGGG -3'
(R):5'- GATTGCATGTTCTGACACTCTC -3'

Sequencing Primer
(F):5'- GTAATTGGGGGAGCAACCTC -3'
(R):5'- CATGTTCTGACACTCTCATCAATAAC -3'
Posted On2018-08-01