Incidental Mutation 'R6718:Parvb'
ID529470
Institutional Source Beutler Lab
Gene Symbol Parvb
Ensembl Gene ENSMUSG00000022438
Gene Nameparvin, beta
Synonymsaffixin, D15Gsk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location84232043-84315688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84297979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 237 (R237W)
Ref Sequence ENSEMBL: ENSMUSP00000023072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023072]
Predicted Effect probably damaging
Transcript: ENSMUST00000023072
AA Change: R237W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023072
Gene: ENSMUSG00000022438
AA Change: R237W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
CH 90 190 3.46e-1 SMART
low complexity region 204 211 N/A INTRINSIC
CH 257 360 9.18e-2 SMART
Meta Mutation Damage Score 0.2669 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Disruption of this marker has no apparent adverse consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Hoxc5 A G 15: 103,014,266 probably null Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Mrgpra3 C T 7: 47,589,696 V161M probably benign Het
Olfr853 G T 9: 19,537,199 H244N probably damaging Het
Otx1 T C 11: 21,996,412 probably benign Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pigu A G 2: 155,301,286 Y232H possibly damaging Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Slc30a9 T C 5: 67,333,100 V218A probably damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Parvb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Parvb APN 15 84303465 missense probably damaging 1.00
IGL02415:Parvb APN 15 84292815 missense probably damaging 1.00
IGL02458:Parvb APN 15 84303434 missense probably damaging 1.00
IGL02937:Parvb APN 15 84308953 missense probably damaging 1.00
IGL03088:Parvb APN 15 84308843 splice site probably benign
R0422:Parvb UTSW 15 84295611 missense probably benign 0.28
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1713:Parvb UTSW 15 84297991 splice site probably benign
R2031:Parvb UTSW 15 84282835 missense probably benign 0.09
R2146:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2148:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2149:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2150:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2508:Parvb UTSW 15 84297970 missense probably benign
R4770:Parvb UTSW 15 84303905 critical splice donor site probably null
R5948:Parvb UTSW 15 84303461 missense probably damaging 1.00
R6492:Parvb UTSW 15 84303872 missense probably damaging 1.00
R6719:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6720:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6722:Parvb UTSW 15 84297979 missense probably damaging 0.96
R7189:Parvb UTSW 15 84303471 critical splice donor site probably null
R7285:Parvb UTSW 15 84282784 missense possibly damaging 0.94
R7492:Parvb UTSW 15 84290450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCACGATGCAAATGATGTC -3'
(R):5'- AGAGATGTTCTCCAGGCTGG -3'

Sequencing Primer
(F):5'- TGTCCTCTCTAAATGATACACCAGGG -3'
(R):5'- GGCCCCTCTGTCCCTACAAG -3'
Posted On2018-08-01